Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCK1
Systematic Name YHR135C
Alias CKI2
Strain S288c
Description Palmitoylated plasma membrane-bound casein kinase I isoform; shares redundant functions with Yck2p in morphogenesis, proper septin assembly, endocytic trafficking; provides an essential function overlapping with that of Yck2p
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YCK1 YHR135C
ATGTCCATGCCCATAGCAAGTACCACTCTAGCAGTTAACAACCTCACCAATATAAACGGA
AACGCAAATTTTAACGTACAAGCAAACAAACAACTCCACCACCAGGCTGTCGACTCGCCC
GCAAGATCTTCGATGACCGCCACGACCGCCGCCAACTCCAACAGCAACTCTTCCAGAGAT
GACTCTACTATTGTCGGCCTACATTACAAGATCGGCAAAAAAATAGGGGAAGGTTCCTTT
GGTGTGCTATTTGAAGGTACTAATATGATCAATGGCGTACCCGTCGCGATCAAATTCGAG
CCCAGAAAAACGGAGGCCCCTCAATTAAGAGATGAATATAAAACATATAAAATTCTGAAT
GGCACTCCCAATATCCCCTACGCGTACTACTTCGGCCAAGAAGGTTTGCACAATATCTTG
GTCATTGATCTTTTGGGTCCCTCTTTGGAAGATTTATTTGATTGGTGTGGAAGAAAATTT
TCTGTCAAAACGGTTGTGCAAGTTGCTGTCCAAATGATTACTTTGATTGAAGACTTGCAC
GCACATGACTTGATATACCGTGATATCAAACCAGACAATTTCTTGATTGGAAGGCCCGGC
CAACCTGACGCAAACAACATCCATTTGATCGACTTCGGTATGGCCAAACAGTATCGTGAT
CCGAAAACTAAACAGCACATCCCATATAGAGAGAAAAAATCACTCAGCGGCACTGCCAGA
TATATGTCCATTAATACTCACCTTGGAAGAGAGCAGTCCAGAAGAGATGATATGGAGGCC
TTGGGTCACGTTTTCTTTTATTTCTTGAGAGGCCACTTACCCTGGCAGGGTTTAAAAGCT
CCAAACAATAAGCAAAAATACGAAAAGATTGGTGAAAAGAAAAGATCTACTAACGTTTAC
GATCTAGCTCAAGGCTTACCTGTGCAATTTGGCAGGTATCTAGAAATCGTCAGAAGTCTT
TCCTTTGAAGAGTGTCCCGATTATGAAGGCTATAGAAAACTATTACTATCTGTACTGGAT
GATTTAGGTGAAACCGCGGACGGCCAATATGATTGGATGAAACTGAACGATGGCCGTGGT
TGGGATCTTAACATAAACAAGAAGCCAAATCTCCACGGATACGGCCATCCAAATCCACCA
AACGAAAAATCGAGAAAACATAGAAACAAACAGCTCCAAATGCAACAGCTCCAAATGCAA
CAGCTCCAACAACAGCAACAGCAACAGCAATATGCTCAAAAAACTGAGGCAGATATGCGC
AATTCTCAATATAAACCAAAGTTAGACCCTACTTCTTATGAAGCTTACCAGCATCAAACC
CAGCAGAAATACCTGCAAGAACAACAAAAGAGACAGCAGCAACAAAAACTTCAGGAGCAA
CAACTTCAAGAGCAACAATTGCAACAGCAGCAACAGCAACAGCAACAGCTACGTGCAACA
GGCCAACCTCCATCTCAGCCTCAAGCGCAAACTCAATCTCAGCAGTTTGGCGCTCGTTAT
CAACCACAACAACAACCTTCTGCTGCTTTAAGAACTCCTGAACAGCACCCAAATGACGAT
AATTCAAGTCTAGCTGCTTCTCATAAGGGCTTTTTCCAAAAATTAGGTTGTTGCTAA
Promoter Sequence
Download FASTA
>YCK1 YHR135C
CAATTACAACTACAACGCCGTAAAGTTCCAAACGCAGCGGCCTGAGATAGTAAATGATGT
ACGCACGTGGGCGAAAGTTCATTACTTTGACTGTTGTAACATACCGTATCTCTCTTTTCC
CACGTGCTCCGCTCTCTTATCTACCTTGGCGGTACAGCCCTGCGCGGAGTCACTGCAGCC
ACGTGCCTAGATCTATTACTATGACTTCCCATGGGCACATATACGCCATTAATATACAAT
ATATATAACGTTCATATATGGGTATTTACAGAGAGCCAGGGGCAAATTGGACAGATGTCT
CCACGCGGCAAAATGGAAACAGCAGTTTCACAAGGACAACACAAACAACTTAAAGATGGT
CACCAGCATAAGGGAAGAAAACTCTCCGAGGAGATCGCTTCTCTATTGAGGCTCAAAGAG
TGCAGGAGGCTCAATCCTGCTAGTTACTATACTCCACGTAGAACATCGCAGTCACAATCT
CTCAGTGGATCAACTTTTAAAGAGTATAACGAGTACATTAATGAGAAAGATTCAAGTAGA
GCGCAGCGTCAAAACGCTGCCGCCGTTTTAAGCAAGCTCGCCCATGACTTTTGGGAGAAC
GACTGTGTCATTGACGAAGACATATTCGAAGATTCGTCTGACGAAGAACAATCATGATTG
CATCTCTTAATCGTTACACATACATACCTTCTACCTCTGTACTGTTACATATGCATTGAC
TTTACGATCTAATATAAATCCTTTTGATGTTACCCCGCCTGTGGGCTCGTTCTCCTTTCG
TTTCTTACGATTTTTTCGCCGGAACAAGAAAAAACAGAACAAAACAAATCAGCGATCGTA
TACATGGGTCTTTGATTTCTGCTTGCTTCTTACAAACAACAAACGCAAACCGTTCATTGA
GTGCTCTGTGACTGGTTTTCATGTGGATGCCATAGTAGAGAAAAGACACATACAAAAATT
TCGCGCATTCGCTGGCCCTTTTCCTGCTCTCCTCTTCCCC
Chr coordinates Chr VIII from 374310-372694
w3c xhtml validator w3c css validator