Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPL2
Systematic Name YHR136C
Strain S288c
Description Protein with similarity to cyclin-dependent kinase inhibitors; downregulates low-affinity phosphate transport during phosphate limitation by targeting Pho87p to the vacuole; upstream region harbors putative hypoxia response element (HRE) cluster; overproduction suppresses a plc1 null mutation; promoter shows an increase in Snf2p occupancy after heat shock; GFP-fusion protein localizes to the cytoplasm
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPL2 YHR136C
GTCTCATCGGAAAAGGCTGGGCGATTAATTCTGGACACAAAATCTTTAACAAAATGTAAG
AGAGGGGGTAAACCCTTGGTTTCTGCATATTGGAAAGAACGTGCAATGGGTAGCTCACTG
GGGGATCCCAAGTCCAAATGCGCCGTGGTAAACGAATTATGCCATTTTGGGTTATCATTA
AAAGGAACTTTTGATATTTTCAAATCCATAGATTCGATAGGAAAAAATCTCTCGTTTGGC
ATTCCACCAGCTAGCTCAATGACGTCATCTGAGATATCAGAAGCATCCCAAAAGCTTTTC
AGAGATCTATTTTCTACTCTTCTGGAGAGAAACGGTTGGAAGTTCTTCTTTAAGGAAGTG
TAATCAACAGGGGGGGCAGAACCAGCAGTCATTGAGTCGATGAGAGAGTGTAATTGTGGT
ATGTGTGTATTTTTATGTTTACACTGGGATATTACAAGACCAAATCAAGCTTTTTCCTTT
ATATATATCAAATATTTATAATGTTTCCTACCCCAATGATGGTTCGGTTATCCGCGGCAA
ATCTCGGTAAGCATCGGCAATGCTTCCGCGAGTTACCGCTTTTTTTTTTTTATTCCTTTG
TTATTATCTACGGCCGTCGGCGGCAATAGTATTTTTGCTCACGTGACCGACAAGGGTCCA
TTTTATTGCGGTACGGCTCTCTCTTTTTTTTTTTCTCCTCTTCAACTTCTCTCTGATTGC
AAACAATATATAACATAACCATGTTCATTACGTACGAAAATATATATACATAAATGCATG
GCAGTTATGGCAATTACAACTACAACGCCGTAAAGTTCCAAACGCAGCGGCCTGAGATAG
TAAATGATGTACGCACGTGGGCGAAAGTTCATTACTTTGACTGTTGTAACATACCGTATC
TCTCTTTTCCCACGTGCTCCGCTCTCTTATCTACCTTGGCGGTACAGCCCTGCGCGGAGT
CACTGCAGCCACGTGCCTAGATCTATTACTATGACTTCCC
Chr coordinates Chr VIII from 375100-374654
w3c xhtml validator w3c css validator