Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARO9
Systematic Name YHR137W
Strain S288c
Description Aromatic aminotransferase II, catalyzes the first step of tryptophan, phenylalanine, and tyrosine catabolism
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARO9 YHR137W
TCGTTCTCCCAAAAGTCATGGGCGAGCTTGCTTAAAACGGCGGCAGCGTTTTGACGCTGC
GCTCTACTTGAATCTTTCTCATTAATGTACTCGTTATACTCTTTAAAAGTTGATCCACTG
AGAGATTGTGACTGCGATGTTCTACGTGGAGTATAGTAACTAGCAGGATTGAGCCTCCTG
CACTCTTTGAGCCTCAATAGAGAAGCGATCTCCTCGGAGAGTTTTCTTCCCTTATGCTGG
TGACCATCTTTAAGTTGTTTGTGTTGTCCTTGTGAAACTGCTGTTTCCATTTTGCCGCGT
GGAGACATCTGTCCAATTTGCCCCTGGCTCTCTGTAAATACCCATATATGAACGTTATAT
ATATTGTATATTAATGGCGTATATGTGCCCATGGGAAGTCATAGTAATAGATCTAGGCAC
GTGGCTGCAGTGACTCCGCGCAGGGCTGTACCGCCAAGGTAGATAAGAGAGCGGAGCACG
TGGGAAAAGAGAGATACGGTATGTTACAACAGTCAAAGTAATGAACTTTCGCCCACGTGC
GTACATCATTTACTATCTCAGGCCGCTGCGTTTGGAACTTTACGGCGTTGTAGTTGTAAT
TGCCATAACTGCCATGCATTTATGTATATATATTTTCGTACGTAATGAACATGGTTATGT
TATATATTGTTTGCAATCAGAGAGAAGTTGAAGAGGAGAAAAAAAAAAAGAGAGAGCCGT
ACCGCAATAAAATGGACCCTTGTCGGTCACGTGAGCAAAAATACTATTGCCGCCGACGGC
CGTAGATAATAACAAAGGAATAAAAAAAAAAAAGCGGTAACTCGCGGAAGCATTGCCGAT
GCTTACCGAGATTTGCCGCGGATAACCGAACCATCATTGGGGTAGGAAACATTATAAATA
TTTGATATATATAAAGGAAAAAGCTTGATTTGGTCTTGTAATATCCCAGTGTAAACATAA
AAATACACACATACCACAATTACACTCTCTCATCGACTCA
Chr coordinates Chr VIII from 375709-377250
w3c xhtml validator w3c css validator