Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR138C
Systematic Name YHR138C
Strain S288c
Description Protein of unknown function; similar to Pbi2p; double null mutant lacking Pbi2p and Yhr138cp exhibits highly fragmented vacuoles; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR138C YHR138C
ATGGTTCTTTGATGCCTGTGAGCCAACTCTGATTGCCAGCAACTCCACAATCAGAACTCA
ATACTCGAATTTTACGAGCGCACAAATATCTTCTAATGCCTCCTCCGGGACCAATACATC
CTCATCATCCTCCAGTCCATTGGTTCCAATTATATACGAAGAAGGATATTCTCAAAGCTT
AATTCAATCACTAAGTTCTAGTATCCAAGGTTTGGTTGTTGTCAGCTCTGGTACAAGTCA
CAACAGTACCGTGGCATCATGGACATCGGTCGACTTCCCTGTCGTTTATGCAAGTGATGG
ATCCAGTGGTCATGATGGTTCAGGAATTGGGTTCATAAGTAACACAAGTATTCCACAAGG
TGCAATTTCTGCTGGGTACTTGTCACCAATCCAAGCGCAAACTTTGTTGTCTATTGCTAT
CCATAATCAAGTCACAAGTAGTAGCGAGTTACAACAAATCTTCCCTGTTAGTCAACAATA
AGATGATTATGTGTTGTGTACTACGAAAATAAGCAAAAAATAAATAAAATAAAAACAAAA
ACAAAAACAAAAACAAAAACAAAAACAAAAACAAAAACACATATTGTTATGATGACTGGA
CGAAAGAAAGATCGTCGTTACTTTCCTAATTGTTTGTCTTCAGTACAGTTATTATCAGTG
TTCTCTTTCTTTTTTATTGTACTATGTGATGTTACTGATACATCACGCGCTTCCTTTATG
TTTTCTTTTTTTATGTTCGTTACAGGATTTATAGTTTTTACAGTATATTGACTTCAATAA
TTTCTAATATTCAGTTCCTATTAAATTTGATTATTCCGATTAGATCGGTCGGCGCTACCA
AAAAGAGGCGAAGAAAAGAGGAAAACGCAAGTGGATAAAGGGGTGGGGGGCAAAAGTATT
TAAGAAAAAGCGATGCGATGGAGAGAACAAATGGATAAGTTGCGTTTCCTCGTTATATTA
CAACATTTAAATCTATTGTGTAACAGACTATAGCATATAT
Chr coordinates Chr VIII from 377699-377355
w3c xhtml validator w3c css validator