Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR138C
Systematic Name YHR138C
Strain S288c
Description Putative protein of unknown function; has similarity to Pbi2p; double null mutant lacking Pbi2p and Yhr138p exhibits highly fragmented vacuoles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR138C YHR138C
ATGGTTCTTTGATGCCTGTGAGCCAACTCTGATTGCCAGCAACTCCACAATCAGAACTCA
ATACTCGAATTTTACGAGCGCACAAATATCTTCTAATGCCTCCTCCGGGACCAATACATC
CTCATCATCCTCCAGTCCATTGGTTCCAATTATATACGAAGAAGGATATTCTCAAAGCTT
AATTCAATCACTAAGTTCTAGTATCCAAGGTTTGGTTGTTGTCAGCTCTGGTACAAGTCA
CAACAGTACCGTGGCATCATGGACATCGGTCGACTTCCCTGTCGTTTATGCAAGTGATGG
ATCCAGTGGTCATGATGGTTCAGGAATTGGGTTCATAAGTAACACAAGTATTCCACAAGG
TGCAATTTCTGCTGGGTACTTGTCACCAATCCAAGCGCAAACTTTGTTGTCTATTGCTAT
CCATAATCAAGTCACAAGTAGTAGCGAGTTACAACAAATCTTCCCTGTTAGTCAACAATA
AGATGATTATGTGTTGTGTACTACGAAAATAAGCAAAAAATAAATAAAATAAAAACAAAA
ACAAAAACAAAAACAAAAACAAAAACAAAAACAAAAACACATATTGTTATGATGACTGGA
CGAAAGAAAGATCGTCGTTACTTTCCTAATTGTTTGTCTTCAGTACAGTTATTATCAGTG
TTCTCTTTCTTTTTTATTGTACTATGTGATGTTACTGATACATCACGCGCTTCCTTTATG
TTTTCTTTTTTTATGTTCGTTACAGGATTTATAGTTTTTACAGTATATTGACTTCAATAA
TTTCTAATATTCAGTTCCTATTAAATTTGATTATTCCGATTAGATCGGTCGGCGCTACCA
AAAAGAGGCGAAGAAAAGAGGAAAACGCAAGTGGATAAAGGGGTGGGGGGCAAAAGTATT
TAAGAAAAAGCGATGCGATGGAGAGAACAAATGGATAAGTTGCGTTTCCTCGTTATATTA
CAACATTTAAATCTATTGTGTAACAGACTATAGCATATAT
Chr coordinates Chr VIII from 377699-377355
w3c xhtml validator w3c css validator