Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR140W
Systematic Name YHR140W
Strain S288c
Description Endoplasmic reticulum protein; may contribute to maintenance of ER and nuclear morphology; null mutant shows discontinuity in nuclear envelope, clustering of nuclear pores, and lacks cortical ER
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR140W YHR140W
AGCCCTTAACTGTTGAATGATCTTTTTCTGGTAGATCATCGGCTTCTTTTGACGCAGGAA
AAGGCCCGTGTCACTTCGGCTTAGCTTCTTTCGGCGATTTTCAAGGGAAGCGTCTGCACC
TTAACGCAGACAAATGACGCATGATATGCACCCTTAAGGCGGACTTGATCTTCAGATCCC
TCAAATGGTAAATGTGCCATAAGGTGGCCAAATTCCAACTAAAAATGATAAATAGGTAAT
GAATTGTTCACTATGCAGCGTTGCCACCGTTACGCCTCCCCCTTATTTTTCATTTCCGTT
TCCATCCAGTTTTTCAGCCTCCTTGAACCCTACCATTAGTAATGGAAGCAATAATCTCAT
AGCAGCAATTGAAAAAAAAAAAGCATATTCGCTCACATTAAAATAATGAGATAACATGAG
ATGGCTTGGAATTATAAGCGTTCGCTGACCTGAAAAAGGCGCGGGGCTAATGGACCCATT
CGTTAAAATGACCTTAAGCATCCACACATGCAGAATAAAAGAACTTAACCTATTCCTTAG
GAAAGTTTATGTATTTGCTGGTACCCTCTTCCTTCTTTGGCCTCTTTTCTGACGTGAATG
TCACATGTTAACATTTTTGTCAAATAGCGTCCATCTATTTGAACAAATGCTATCATTTTT
GGGGATACAAATTCTATAAGAGGTTCCTGTTTGCAGCATCTAAAAACAGAGCGTGAAACG
CATGCAGAAGTGACATATAATCCTTTGTTTAAGCGACAATTAAAAATAATGATCGCTCTC
TTTTCCTTTTCAGACTTGCTCATTAAATTTGACAAGATCCGCGGATTAGAGAAGTCTGCG
CTTCGCATTTAATGAAAAGATCTCCGATAAGTATATAAGTCCCTTTTTTCTCGAATTATA
TAAGTCACTTTCTATATGTCAGTGATTATCTCTACACTAGTCTTGCTGTATTCTTAGCAA
ATTTTTCTCGTATTTTAAAACCATAATACAAGGAGAATCC
Chr coordinates Chr VIII from 380572-381291
w3c xhtml validator w3c css validator