Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DSE2
Systematic Name YHR143W
Strain S288c
Description Daughter cell-specific secreted protein with similarity to glucanases, degrades cell wall from the daughter side causing daughter to separate from mother; expression is repressed by cAMP
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DSE2 YHR143W
CATATATAGAAAATAGGTGTATACTATTAGTTTAATGTAATAAGCAGGACTATGACAAAC
CAAAGAGTGAAAGTAGCCGTTTCCACGTTTTAACGGCTTGTGTACACTTTGACAGTCAAT
CAGCGTAGTGACTTCTTTTATCAGCGGAAACAACCATATCCATAAAAGAAACGTGATGGT
CGTTCCCGTAGTTTATTAAGTAAGATGACAAATTATCCTTCTTTAGTCAATTGAAAACAA
AACTTCTTAATCTGTTTCCAATGTTTTAAAGTCGCTCATATGTTCATGACTACTTTTCCA
TGAGAGGGTTCTACGAAAAGCATCATCTTATTTTCGCAACGCTGCGGGTTTAGGCCTTTC
CGCTGGTCTCTTTTCTGTTTACAGTTCTGCCCGAATGTAAACAAATACTTTGCGAAAAGT
AAATAATGTATTCTGAAAAAAAAAAAGAGAACTGTGAACAATGCTTGATAGTTGTAGGAA
TATCTTAGAAGAAAGGGGATAGATTATCTGGAAAATCGTTTGAATAAAATAAGAACCAGT
AATTCATTCGTTTAAATTGGAAAAACAAAACATAAAAGAACCAGCAATGTCTTGGTTGCC
TGTTAATGTAAAAAGTTCTCCCAAAAGATGACAGGAAACTCGTTAACTCATACTCGGTAT
ATAAGAGGAAACTTATCTAATGTTTCATTCATTCTTCCTCTTCTGCTTATTCGATGTCTA
TTGAAAAACTTCAAGTAAACCAGCAATATCGACTTCCATTAAGTAGACAGCGAGCCTGAA
ACAAAGAATATACTGTTTCAATTCCAACTAAAGCCACTCCCTCAAGCGTTATTATTTTTT
GAATTATATTTTCGGGTTTTAAGCTAACTCTAGTCATTCCTTACTACATTTTATTGTAAC
TCTTCAGTAGAGCTAACCACAGTCATTCCTTAATATTTTTTAACACAGATCTCTTTCACA
GAGTAGAAATAAAGCCACTCCTTTAACAAATTACAAAGAA
Chr coordinates Chr VIII from 385510-386487
w3c xhtml validator w3c css validator