Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CRP1
Systematic Name YHR146W
Strain S288c
Description Protein that binds to cruciform DNA structures
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CRP1 YHR146W
GCAATTCTACACAATTCTATAAATATTATTATCATCATTTTATATGTTAATATTCATTGA
TCCTATTACATTATCAATCCTTGCGTTTCAGCTTCCACTAATTTAGATGACTATTTCTCA
TCATTTGCGTCATCTTCTAACACCGTATATGATAATATACTAGTAACGTAAATACTAGTT
AGTAGATGATAGTTGATTTTTATTCCAACACTTTTATATATTCTGTATTTGATGTTATAG
CTTTATCAATTACAGAATGCCAAAAATTATCAAATTATTCACCAATATCCCAAATTTTAA
TGCAACCGTTATGATCCGACTATTGATAAAGGAAATTCCTATTCTACATAATGTTACTGG
TATTTCTTCTTCCGTTTTTTATGTCGTCATTCGTCATCCTATTGCATTATCAATCTTTGC
GTTTCAGCTTCCATTAAATTATGAAGATTATTTTTCAATCTTAAAGTCATCTTCTTACAC
TGGATATAATAATATACTAGCAGTATGAATATTAGTCGATAGACGATAGTTGGTTCTATT
TCGACGGGTAATATTCTACTAATACCAATGACACTATTAATTTACCTAACAGAAATTCTT
CTTCAATTGACCCTAGCGTTTGCCTTATTATCAAGACACTGAAGGTAAAGTTGCCGATAA
ACTTTTTGGGTTCCACTGTGCACCTATTTCTATGCTTCAATAAGCAGTTCCAGGTAAGGT
TTCACCATTTCAACCCAAGTAAATGCTATGTAGTTATAATATTAATTAATGTGTTCTACT
GGTTTTTCTGTGCATAAAAAAGACGCTCTGACGCCATTTATCTTGGTGTGTTACCCGTTA
GGAAAAGTGGCGTTGCTAAAATTGTTGAAACCCGATCTCATCGCCTGGTAAACAATACAA
ACAAGGATTTGAACAAGGTTTTATCATTTTCTGATACGTTTTTTGTACTTACAAAATAAA
AGATACAAAAATCACTAAGAAAACTAATCTATCAATAAAA
Chr coordinates Chr VIII from 390300-391697
w3c xhtml validator w3c css validator