Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRPL6
Systematic Name YHR147C
Alias uL6m, YmL16
Strain S288c
Description Mitochondrial ribosomal protein of the large subunit
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRPL6 YHR147C
GCGGTTTTTCTTATTTTTGCATACGACGAAGAAGTTCCTTTGTGTATATAACAATTTTTC
ATGCTTCCAGCTTTTAAGAAAGCTCAGGCGCCTCACATCATTTGTATTTGCTGCCTCGTT
GCCTATTCGTAATAATTTCACAATGTAGGAAGATGATAAATCGAGTATTGATACAGAAAA
CGTAAGTTTGTAGTCAATTTATGAAAAATCAAAATCGTCGATTTGGTTTCTGTATCTCAA
CAAGGTTTTCTTGATCTTAGAGTTGTCCACCCAAGTAACGTAGTCCTCCATATTTCTCGT
TACGAGGTAGGCTGGATCGTTGATCAAATTTGGACCCACGCGAACATGCCCTTGTTCAAT
GAACTTGACTGCATCTTGTATAGTTTCCGCCATTTTTAATCTATGCATTATTACAGGTAA
TCGCCTCCTACAGATGGCACTAACAGTAACTTTATTTTCCAGATCAGAAATCTTTGATTT
AGTTGTCAGGACACCCATAGCGTATAGCTTGTCCAGTAATAATTGCTCATGTTTGCGACG
AAATGGATCAGTGGGAGGTAATAATGATAATTTATTGGCAAGACGACGAATATCACCGCA
TATCCTATTGTATTTATGATAATCTTCACGATTCTGAATATGATATGTTCTCATGACCTG
AGTGTCCCGGTGGCCTTGGTCCTGCTTCCATTCAAGGAAGTCTACTTTTTTCAATAACTT
TTGCTCATGATGCTTTAGTTTTCTAACCATTATTGGTTGTGATTATGCCTGGTGGTTTAT
CTATTTAGAACGTTCTATATTACTTATCCCATTGAATTTTTGTTGCGATGAGCTTATATC
AGTGAAATTTTTTTCACTGGAAGTAGAGGGTAATGAAAGGCGAGCGGAAATAGCGAGGAG
ACGCTACGGTTATAGAGGAAGAATATCAAATACTAGTAAGTAAGGGAAGATCACGCAATA
AAGCTATCGCAAATCTTACTATAGGAATTGAGGCCAACCT
Chr coordinates Chr VIII from 393283-392639
w3c xhtml validator w3c css validator