Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMP3
Systematic Name YHR148W
Strain S288c
Description Component of the SSU processome; SSU processome is required for pre-18S rRNA processing, essential protein that interacts with Mpp10p and mediates interactions of Imp4p and Mpp10p with U3 snoRNA
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMP3 YHR148W
ATTTTCATAGGATATTTACAAGGTATTCCCTATAAAGTATAAGAAAAGATACATGTCATA
AAAAAAATTACGAAAATGAGTACGAAAATAACTGAAATCCTGAAGTTATTTGATTTTCTT
GTCCTTTAGCTTTATTGTTTCATCGTTAACGTATATTCCTTTGCCTTTATACGGCTCTGG
TGGATGGAATTTTCTCAATTTGGCAGCAAAAAGAAGGACCTGCTGCTTATTGCACCCTTC
AATAATCAGAGACGTGGGAGCAGGTGTTTTGACAACAATACCTTCAGGAACGTCCAATCC
TTGTTTGATAGATGCACCCACCTTAACGTTGACAAATTTACCATCATTTTCTAATTGAGC
TCTATAACCTGTCCCTACAAATCTAAGGACAGCAAGATGCCCCTCAGTAACACCTATAAT
GTGATTATTTATAAGTGATCTTACTGTACCCCACATCGAACGTTGATGTTTATCTTCTGA
ATTCTGAACTGTAACATTTATTTTACCGTGCTTTTCATCCTTGTCCAAGTGCAAAAAATC
AGGGACCTCCACGGACAATTCACCCTTGGGTCCCTTTACTGTGATATTCTGTGATATATT
CATTGAAGTTCTACCTTTTCTGATAATCCTGGGCATGGATAATGCATTTATGGAAACCTG
AACTTCAGGAGATATATAAAGTGGTAAAGACCCCACTTGAGAGCGCAGAAAAAGTGTTTG
CGACAATAACCTCCTCTGAATAAATGACATAGGTTGGCCTCAATTCCTATAGTAAGATTT
GCGATAGCTTTATTGCGTGATCTTCCCTTACTTACTAGTATTTGATATTCTTCCTCTATA
ACCGTAGCGTCTCCTCGCTATTTCCGCTCGCCTTTCATTACCCTCTACTTCCAGTGAAAA
AAATTTCACTGATATAAGCTCATCGCAACAAAAATTCAATGGGATAAGTAATATAGAACG
TTCTAAATAGATAAACCACCAGGCATAATCACAACCAATA
Chr coordinates Chr VIII from 393534-394085
w3c xhtml validator w3c css validator