Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LIN1
Systematic Name YHR156C
Alias SNU40
Strain S288c
Description Non-essential component of U5 snRNP; nuclear protein; physically interacts with Irr1p of cohesin complex; may link together proteins involved in chromosome segregation, mRNA splicing and DNA replication
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LIN1 YHR156C
TACATCAGCGCAGAATAGTCCGATTGCAGTATTTGGGCGGTGCTGGACGAAGATATGGGT
CTGATTTCATTTACTTCACTTCGTAGCAATGTAAAGCTAAATTCATCCTCTATTTCATCT
CCTGCTTGATCATTCCTCTGTATTAAAGGATCGTCATATAATGTGTCACTATACAGAAGA
CAGGTATCATTATTATTGCTTTCCACCCTCTTCGGCATGCATACTGGGTCGCCTAAGATA
AACGGAAGAGATACTGTTGCAGATTTCTTAAAGGAATTGCTTAAGAGGTACGTTGAAGCT
GTTCGTTTTAACCCAGGCTTAGGATAGTTTGTCCATGACATGATACAATTTACTGCCTTA
TCAAATTCATCTTTATTTATCCTTTTTACGGTCTTGTTATTTAACCCAAATTGAATGCTA
ACCCTTTCAGTTACAAAGTATTGGTGAAGAAAGTCTTGCGTACATGTGATCTTATTTGTA
TCTTCCTCCTCGATGGACATGTTGTCCAAGTTGCTGTATGTTCTTTTCTTCAGCAGTTTG
TTTTCTTATACAAAAGATATATTTTATTTGGTATAGCGGAAAATAGCCGCCAAATATTGT
GCGTCAAAGTTGAAGAAACATAAAGTTTAACACTACTGGTTTATGAAAGAAAAGACTACA
TTTGTAAGCCTACTCCAAATTGACCTTTGAATAAGTGTGGCTTACTCTATTAGCTAAAGG
ACATTATCACTCATCACCATGAACATTCAGTAGTAACATAAAAGTCCCTGCCTTGTTTGT
GAATGAGGGTCCCTTCCTTTACATTCTACCAACATAGTCTCCTTTTCTTCCATTTATGCC
CTAATAATCGATTTTAATTACTTAATGGGTAAGTTTCTCTGACTAGATTAAAAGAAGCGC
ATCCGAACAAATTGGAATGACCATGCTAAGCTGCCTTTTAAAGAACAAGGGAAAACTTTG
ATAAAAACACTCAAGTGCACCATATTGTTTGTAGAAGGAT
Chr coordinates Chr VIII from 412406-411384
w3c xhtml validator w3c css validator