Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LIN1
Systematic Name YHR156C
Alias SNU40
Strain S288c
Description Non-essential component of U5 snRNP; nuclear protein; physically interacts with Irr1p of cohesin complex; may link together proteins involved in chromosome segregation, mRNA splicing and DNA replication
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>LIN1 YHR156C
ATGAAATATACGCAATACCCGAACAGCTCAAAACTGAAAAGAAATAGTGATCGACGTGAA
CACGACGAAAAGCTTAGCGATGAGTTACATAATCAAAGTACGATATATGAAGATGAAGAG
CTAAGCAGGGCAGAATATGATTCTGATTCTGATTCTAGCGTTGAAGATTCTACAGATAAT
GAAAATAGTGGGAAAGAAATGGATGAAAAATCCTATGAAAAAAATGAAGATCACGTCGAA
GACCATAGAAAGCGAAAGAAATCGAAAATTCAGCTTTTGGATATTGCAGAGTTCAAGAAA
GAAAACTTAGCCGACTTAGATTATCAGATCGGTAATTCAGAGAGCAAGGTAGAAAAAGGT
GTGAATATAGAGCCATTTAATATAGATGACGAAATAAAACATGGGGTATTCGATAAAGAT
GGGAATTATATTAAGACAGAAAACGCCACAGAAAATGATCAACAAGATAATGAGGAATGG
ATGAATGATGTCATAAATACAGAGGAGGTAAATCGCTTAGAAAAGGAACAAAGTGTCAAA
ACGCAGAATTCGAGACATTATATGGTCCACGAAGCATTAAATCTTTTGAAATTTTTTCTT
GTTGATGAGAATGAAACAGTACTGGAATCCTTGGGCAGGTTAAACAAGCTGCGAAAAATT
GCCATTTCAAAAAAGAACAAATCATTGAAATATGTTATTCACGGAATCGAGCTATTATCT
GATTTGATCAATATACTAGAAAAAAAGGGATTCAGTGAAGTATATGAATATAACCGCTTA
AAAGTTCAGGATGCTATAGAAGAGGAAATTTTCGATGACTCCTCCAGAATAGTTAACCAT
AAAACAAAGTTATGGGGCTTCAAGTGGTTGAACAAATTAGATGAATATCACGGCCTGTAC
ACGAACTATGAAATGTCTTATTGGCAAAAATCCTACTTCAAAAACAGTGTTATAGTAAAA
TTTCACAGCGAACCAGATCGAGATGAAAACTGGATACATGTATCGTGTTTAAGTTTCATG
TAA
Promoter Sequence
Download FASTA
>LIN1 YHR156C
TACATCAGCGCAGAATAGTCCGATTGCAGTATTTGGGCGGTGCTGGACGAAGATATGGGT
CTGATTTCATTTACTTCACTTCGTAGCAATGTAAAGCTAAATTCATCCTCTATTTCATCT
CCTGCTTGATCATTCCTCTGTATTAAAGGATCGTCATATAATGTGTCACTATACAGAAGA
CAGGTATCATTATTATTGCTTTCCACCCTCTTCGGCATGCATACTGGGTCGCCTAAGATA
AACGGAAGAGATACTGTTGCAGATTTCTTAAAGGAATTGCTTAAGAGGTACGTTGAAGCT
GTTCGTTTTAACCCAGGCTTAGGATAGTTTGTCCATGACATGATACAATTTACTGCCTTA
TCAAATTCATCTTTATTTATCCTTTTTACGGTCTTGTTATTTAACCCAAATTGAATGCTA
ACCCTTTCAGTTACAAAGTATTGGTGAAGAAAGTCTTGCGTACATGTGATCTTATTTGTA
TCTTCCTCCTCGATGGACATGTTGTCCAAGTTGCTGTATGTTCTTTTCTTCAGCAGTTTG
TTTTCTTATACAAAAGATATATTTTATTTGGTATAGCGGAAAATAGCCGCCAAATATTGT
GCGTCAAAGTTGAAGAAACATAAAGTTTAACACTACTGGTTTATGAAAGAAAAGACTACA
TTTGTAAGCCTACTCCAAATTGACCTTTGAATAAGTGTGGCTTACTCTATTAGCTAAAGG
ACATTATCACTCATCACCATGAACATTCAGTAGTAACATAAAAGTCCCTGCCTTGTTTGT
GAATGAGGGTCCCTTCCTTTACATTCTACCAACATAGTCTCCTTTTCTTCCATTTATGCC
CTAATAATCGATTTTAATTACTTAATGGGTAAGTTTCTCTGACTAGATTAAAAGAAGCGC
ATCCGAACAAATTGGAATGACCATGCTAAGCTGCCTTTTAAAGAACAAGGGAAAACTTTG
ATAAAAACACTCAAGTGCACCATATTGTTTGTAGAAGGAT
Chr coordinates Chr VIII from 412406-411384
w3c xhtml validator w3c css validator