Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name REC104
Systematic Name YHR157W
Strain S288c
Description Protein involved in early stages of meiotic recombination; required for meiotic crossing over; forms a complex with Rec102p and Spo11p necessary during the initiation of recombination
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>REC104 YHR157W
GTATTTATGACATCATTCATCCATTCCTCATTATCTTGTTGATCATTTTCTGTGGCGTTT
TCTGTCTTAATATAATTCCCATCTTTATCGAATACCCCATGTTTTATTTCGTCATCTATA
TTAAATGGCTCTATATTCACACCTTTTTCTACCTTGCTCTCTGAATTACCGATCTGATAA
TCTAAGTCGGCTAAGTTTTCTTTCTTGAACTCTGCAATATCCAAAAGCTGAATTTTCGAT
TTCTTTCGCTTTCTATGGTCTTCGACGTGATCTTCATTTTTTTCATAGGATTTTTCATCC
ATTTCTTTCCCACTATTTTCATTATCTGTAGAATCTTCAACGCTAGAATCAGAATCAGAA
TCATATTCTGCCCTGCTTAGCTCTTCATCTTCATATATCGTACTTTGATTATGTAACTCA
TCGCTAAGCTTTTCGTCGTGTTCACGTCGATCACTATTTCTTTTCAGTTTTGAGCTGTTC
GGGTATTGCGTATATTTCATATCCTTCTACAAACAATATGGTGCACTTGAGTGTTTTTAT
CAAAGTTTTCCCTTGTTCTTTAAAAGGCAGCTTAGCATGGTCATTCCAATTTGTTCGGAT
GCGCTTCTTTTAATCTAGTCAGAGAAACTTACCCATTAAGTAATTAAAATCGATTATTAG
GGCATAAATGGAAGAAAAGGAGACTATGTTGGTAGAATGTAAAGGAAGGGACCCTCATTC
ACAAACAAGGCAGGGACTTTTATGTTACTACTGAATGTTCATGGTGATGAGTGATAATGT
CCTTTAGCTAATAGAGTAAGCCACACTTATTCAAAGGTCAATTTGGAGTAGGCTTACAAA
TGTAGTCTTTTCTTTCATAAACCAGTAGTGTTAAACTTTATGTTTCTTCAACTTTGACGC
ACAATATTTGGCGGCTATTTTCCGCTATACCAAATAAAATATATCTTTTGTATAAGAAAA
CAAACTGCTGAAGAAAAGAACATACAGCAACTTGGACAAC
Chr coordinates Chr VIII from 412907-413455
w3c xhtml validator w3c css validator