Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEX18
Systematic Name YHR160C
Strain S288c
Description Peroxin required for targeting of peroxisomal matrix proteins containing PTS2; interacts with Pex7p; partially redundant with Pex21p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX18 YHR160C
TGCTGGCGTAAGTGCCCAACAAACGGGGTACTATTCGATTAACAACCATTTAACACCCAC
ATTTACAGGTGCAGGGTTTGGAGGATACTCCGTTTCACAGGATACAACTGCCGCTTCTAA
TCAACAAGTCTCTCATTCACAAACTGGTTCTAACAACCCGTTCGCATTGCACAACGCCGC
GACGATCGCAACAGGGAATCCTGCACACGAAAATGTCTTAAATAACCCATTTTCACGACC
AAACTTTGATGAACAAAATACCAATATGCCGCTACAACAACAGATAATAAGTAACCCTTT
TCAAAACCAAACGTACAATCAACAACAATTTCAACAACAAAAAATGCCTTTGAGCTCGAT
CAATAGCGTTATGACAACCCCTACTAGCATGCAGGGATCGATGAATATTCCTCAGCGTTT
TGATAAAATGGAATTTCAGGCTCACTACACTCAGAATCATCTCCAACAACAGCAACAACA
GCAACAGCAACAACAGCAACAGCAACAACAGCAACCACAACAGGGTTATTATGTGCCTGC
AACTGCAGGAGCCAACCCTGTTACAAATATAACTGGGACAGTTCAACCTCAAAATTTCCC
TTTCTATCCACAACAGCAACCACAACCGGAACAGTCTCAAACACAGCAACCAGTTTTAGG
AAACCAATATGCTAACAACCTCAATTTAATTGATATGTAATATCTAGTATAATCAGGTAT
GTAAGGGAGTACTCAAGTGCATCTTTGGATAGCTATATATAGTTGTAAGGAAGAGCTATG
TAATTTTTGCCATTTTGTACATATTTTGCATTTGTCCTATAGTATGTAATACTTACATCT
TACTGTCTTCAATTCCTCCCGCCAACAAAAGATTTCGATAGCGCCGCACCATGGAGTTTA
TATTGTTATTTCCGAGACGACCTATATAAGGGAAAAGACGAAAACTGGGTATTTGATACT
TGTCTAAACTTCAATGGACAAATGATATAAAATACAAACA
Chr coordinates Chr VIII from 420072-419221
w3c xhtml validator w3c css validator