Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MPC2
Systematic Name YHR162W
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the mitochondrion
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MPC2 YHR162W
TTGGAACCCTCCCTTATCATCAAATGAACCACCAACAGCGATTTATACACAATAGTCCAC
GCCGTGTCATTAATTCGGGAATCCAAACCCTTCACGATCTCATAGAAATCCTCTTCATTG
CTGGTCCCCAACAGTATCGGATCCAGATACTTCTGTTTGGGCGGGGCTGACTTGATCTTG
GTAGCACCTTTTACCAACTTGAAATATGTTGTCATCTCGCCTCAATCGAAATTTATACTC
TAGTATCTGCGATATCGAACAGTCCCTTTATATTTACGAGACAGGTTTTGTCCTTCCTCC
CCCACCAAAAAGACGCTATAAAATACTAAATATATCTAATATCGCTACTGCTCAATTCAC
CTAACGAATGATTACCACCAAGCATCAACACCATGTGCATACCATACCGCTAACTAAACT
CACCAACGCTGGAAGCCTGAATACCAAGTATCGAACTGAGGCCCCTGTGTTACCAATCCG
TAAAAAGTGATGGAACCCGCCGCTCGCTTCCAAGAGTTATCATCATATTCTTCATCATAT
TCTTCCATACTTAAGGTGGGTAGCGAGGACCCCTCAATTCCCCCACCTCTCTGCCAGGGC
GTCATCTTTTTCTACAAAAGCCAGGCTGAGTCACGTCAGTTGCTGACCCTGGGGGCTGCA
TTGTTTCCTACGAATTACTCATTTGTTTCGTGCGCTTTCCTATTGCGCGCATGACTAGGA
TGGAAAAAAAAAGAAGAAAAAGAAAAGCGTTGAGTATATAATAAGAAAGAAGAAAAAGTC
CGAGAGAAAAGAAGCACAAAGGTTTTTCCTCGAGGAAAACAGTAAAGTTTGATACGCACA
TCGTTGACATCGCTGACTGCAATAGGAAACTGAAATAGACGGCAAACCATTAGTTCATTC
GAAAGAACGTATTGTCGAGAATTATCACTCACTATATCAGAAAATTGACACACGAATTAT
ATAAACGAAGTTATACAGAAAAAGATTAAAGAAAAGAAAA
Chr coordinates Chr VIII from 423072-423461
w3c xhtml validator w3c css validator