Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name THP2
Systematic Name YHR167W
Strain S288c
Description Subunit of the THO complex, which connects transcription elongation and mitotic recombination, and of the TREX complex, which is recruited to activated genes and couples transcription to mRNA export; involved in telomere maintenance
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>THP2 YHR167W
ACGACATTGCCTTAGAAATATTCTTCTCTTGCTTTAAGATGACCCCTCGTAAATAATACA
ACAGTGCTAACCCTAAATCGGCCTCATCATCGTCTATCTTTATTTCATAAGACTCCAGAA
ATGTGTTAATTTCCTTCAAAATAGATGATATGTTCGATTGTGACTCATGCTCATTGCTGA
CCATTTTTAAATTGGCGCGTTGGTGCCCACTTTGATTTATATCCTCATTCCCACTACCAT
CCCCATCTTTGTTAGCTCTGTACATTTCGTCCGTAAACTTCCCTGTAGTTAAGATATTTT
CCATACTTTCCTGGCTTTTCTTATCCCACGATAGAAATTTACTGTATAATTTTAAGAACT
TAAGGTATGGATTAGTGACATCTTTTAGAAAAAAAACGCATCGATCAAACTCTTTAGCAT
CAAACAACGTAGAACCAAGGAGGTACAGGTCATACTCAGTCTCTGATAGGCCAAACCCGT
TTTGTGGTATTTCAAACATCTGTTTCGGTACACCTTGTTTATTTCTTAGTGGCGATTCAT
CGGCTAAAGAGTGTGTTTGATCAACATCAATAGCTTCTGCAAGACCTGCTAGCGCCTCTG
CTGCCCACTTTGAGGAGCCGTATAGCTTCCATCGTGATAATTCTGTGGCAGCCTTTCGTA
GCTGAATACGTATATCATGTATTATTTTATCCTGGCTGTCGTCATTCATGGTTCTAAATG
CTTCACAATCTGATTCTGATCAGTATATATCCAGATTTCAGTTTTCCGCTCGCTAATACT
CCCTTCTTCCTCTTAATTTGATGTGAGTACCGCAGTACTTGGTCTGCTATTATGAAGTGT
TTGTTTTACCCGAAGTGCTTTTTATGTACGCGCATTGAAAAATAATAGAAACTTGGTAAG
TAGAATACTTAAGAAGCTGCAGAAGTGCAGTATCTTACAGTAAGAAACAACAGCGACTAG
TTTATCAGGTTTACACTGCTCAAGTTATCAAGTTCATAGC
Chr coordinates Chr VIII from 439342-440127
w3c xhtml validator w3c css validator