Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NMD3
Systematic Name YHR170W
Alias SRC5
Strain S288c
Description Protein involved in nuclear export of the large ribosomal subunit; acts as a Crm1p-dependent adapter protein for export of nascent ribosomal subunits through the nuclear pore complex
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NMD3 YHR170W
AAGTGTAGATAATGTGGCTATTCCATCGACGTTGAAAATAGAGTATATCTTGGTTCCAGA
ACACGTCAAAGAAGCATATTTGTACCAATTATTAACATGCGAGGAATATGAGAATAAAAC
CGCTATAATATTTGTAAATAGAACAATGACCGCGGAGATCCTTAGAAGAACCCTGAAGCA
GTTGGAAGTGAGGGTAGCGTCGTTGCACTCTCAAATGCCCCAACAGGAAAGAACAAATTC
CTTACATAGATTTCGAGCTAACGCTGCAAGAATCCTCATCGCTACAGATGTAGCATCCAG
AGGTTTGGATATCCCAACTGTTGAGCTTGTAGTGAATTACGATATACCTTCAGACCCAGA
TGTATTCATCCATAGATCTGGTCGTACGGCCCGTGCTGGCAGAATTGGTGACGCCATATC
ATTCGTTACCCAGCGAGATGTTTCTAGGATACAGGCCATTGAGGACCGTATCAACAAGAA
GATGACAGAGACAAACAAGGTACACGATACCGCTGTAATAAGAAAAGCCTTGACCAAGGT
AACCAAGGCGAAGAGGGAATCGCTGATGGCAATGCAAAAGGAAAACTTCGGTGAGAGAAA
AAGACAGCAAAAGAAGAAGCAAAATGACGGGAAAAGTTTGCGCTCTTGAAAAATTCTAAA
TAAGATTTAAAGACGTACATATCGTACAATCTGGATACTGTTTTCCAGGACAACTGATAG
ATACAATTTTGGCACATATGAAGTATGTTTCTATATAACGGGTGAGAAAATCGCTGTAAA
TTCAATTACGTACAATCACCGACGGGTAACTTATTTTTTTTTCTTTTTCTCTTGTAGTTG
GAAAATTTTTTGAAGCTCATCGCATTGGAAAAGAAAAATTACTAGCAGTTGTGATGATTT
AACTATGTTTTGAGGAACCTTGGCTTTATCTTTTATTTGTCGCCTGGTACATAACACTAC
ATTTTATTGTCTAATAAACGTTGAGGAATTTGACAAAAGG
Chr coordinates Chr VIII from 443828-445384
w3c xhtml validator w3c css validator