Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG7
Systematic Name YHR171W
Alias APG11, APG7, CVT2
Strain S288c
Description Autophagy-related protein and dual specificity member of the E1 family of ubiquitin-activating enzymes; mediates the conjugation of Atg12p with Atg5p and Atg8p with phosphatidylethanolamine, required steps in autophagosome formation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG7 YHR171W
CTGTCACCATCTGTGTACTGGAGGGCTCCATTCAACGCCCTGGCTGATGTGACCCAGTTG
GTGGAGTTCATTGTTCTGGACGTGGATTCTACAGGTATAAGCAGGGGAAATCGTGTCTTA
GCTGACATTACTGTTGCTAGAACGTCTGACTTGGGTGTTAATGACCAAGTCTACTACGTC
AGGTCTCATCTCGGTGGTATTTGCCATGCAGGTGATAGTGTTATGGGTTATTTCATTGCA
AACTCGAATTACAACTCAGATCTTTTTGATGGGTTAAATATCGATTATGTGCCTGATGTA
GTTCTTGTGAAGAAATTGTATCAAAGAAAGAGCAAAAAGAGCAGACACTGGAAGTTAAAG
AGAATGGCTAAGGAACACAAAGATATCGATGCATCCTTAGATTACAATTCAAGAGCTCAA
AAGCAAGAAATGGAACGTGCAGAAAAGGACTACGAATTATTCTTACAAGAATTAGAAGAG
GATGCTGAATTAAGACAAAGTGTTAACCTATACAAAAACCGCGAAGCAAATGTACCTCCT
GAAGAGCATGAAATGGATGAAGACGAGGATGAAGACGCTCCACAAATCAACATTGATGAA
TTATTGGACGAGTTAGATGAAATGACATTAGAAGATGGAGTCGAGAACACACCCGTTGAA
TCTCAGCAGTAAAAAAACACCAAAGAATGGAGAGTAGTATATACTCTTAACAAACACTAG
CATTTCAGTTTATCTATATACATATATATGGATGTAAAATGTACTTTATGGAAGAACAAG
CCACCACATGTTGAAAACTAGATAGGCAAGCAAGATTTTTCATTTGTAGAGCTCTTACGC
AAGATTTTTAAACTTCCGCTTTTTTAATCCATGAGATTCCTTTGGACACCCTTTCCGGCA
CGGCAAAACAAAAAAATTAAGGGAACTCATTATTTTACGATGCTACTTAGATAACTAAAG
TTCATTATATTTCAACAAATATAAGATAATCAAGAATAAA
Chr coordinates Chr VIII from 445713-447605
w3c xhtml validator w3c css validator