Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ENO2
Systematic Name YHR174W
Strain S288c
Description Enolase II, a phosphopyruvate hydratase that catalyzes the conversion of 2-phosphoglycerate to phosphoenolpyruvate during glycolysis and the reverse reaction during gluconeogenesis; expression is induced in response to glucose
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ENO2 YHR174W
AATCCTACTCTTGCCGTTGCCATCCAAAATGAGCTAGAAGGTGGATTAACAAATATAATG
ACAAATCGTTGCTTGTCTGACTTGATTCCACTACAGTTACAAATATTTGACATTGTATAT
AAGTTTTGCAAGTTCATCAAATCTATGAGAGCAAAATTATGTCAACTGGACCCCGTACTA
TATGAGAAACACAAAAGCGGGATGATGAAAACACTAAACGAAGGCTATCGTACAAACAAT
GGCGGTCAGGAAGATGTTGGTTACCAAGAAGATGCCGCCCTGGAATTAATTCAGAAGCTG
ATTGAATACATTAGCAACGCGTCCAGCATTTTTCGGAAGTGTCTCATAAACTTTACTCAA
GAGTTAAGTACTGAAAAATTCGACTTTTATGATAGTTCAAGTGTCGACGCTGCGGGTATA
GAAAGGGTTCTTTACTCTATAGTACCTCCTCGCTCAGCATCTGCTTCTTCCCAAAGATGA
ACGCGGCGTTATGTCACTAACGACGTGCACCAACTTGCGGAAAGTGGAATCCCGTTCCAA
AACTGGCATCCACTAATTGATACATCTACACACCGCACGCCTTTTTTCTGAAGCCCACTT
TCGTGGACTTTGCCATATGCAAAATTCATGAAGTGTGATACCAAGTCAGCATACACCTCA
CTAGGGTAGTTTCTTTGGTTGTATTGATCATTTGGTTCATCGTGGTTCATTAATTTTTTT
TCTCCATTGCTTTCTGGCTTTGATCTTACTATCATTTGGATTTTTGTCGAAGGTTGTAGA
ATTGTATGTGACAAGTGGCACCAAGCATATATAAAAAAAAAAAGCATTATCTTCCTACCA
GAGTTGATTGTTAAAAACGTATTTATAGCAAACGCAATTGTAATTAATTCTTATTTTGTA
TCTTTTCTTCCCTTGTCTCAATCTTTTATTTTTATTTTATTTTTCTTTTCTTAGTTTCTT
TCATAACACCAAGCAACTAATACTATAACATACAATAATA
Chr coordinates Chr VIII from 451327-452640
w3c xhtml validator w3c css validator