Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CTR2
Systematic Name YHR175W
Strain S288c
Description Low-affinity copper transporter of the vacuolar membrane; mutation confers resistance to toxic copper concentrations, while overexpression confers resistance to copper starvation; regulated by nonsense-mediated mRNA decay pathway
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CTR2 YHR175W
AGCCATGAGAATTGGTTCCGAAGTTTACCACAACTTGAAGTCTTTGACCAAGAAGAGATA
CGGTGCTTCTGCCGGTAACGTCGGTGACGAAGGTGGTGTTGCTCCAAACATTCAAACCGC
TGAAGAAGCTTTGGACTTGATTGTTGACGCTATCAAGGCTGCTGGTCACGACGGTAAGGT
CAAGATCGGTTTGGACTGTGCTTCCTCTGAATTCTTCAAGGACGGTAAGTACGACTTGGA
CTTCAAGAACCCAGAATCTGACAAATCCAAGTGGTTGACTGGTGTCGAATTAGCTGACAT
GTACCACTCCTTGATGAAGAGATACCCAATTGTCTCCATCGAAGATCCATTTGCTGAAGA
TGACTGGGAAGCTTGGTCTCACTTCTTCAAGACCGCTGGTATCCAAATTGTTGCTGATGA
CTTGACTGTCACCAACCCAGCTAGAATTGCTACCGCCATCGAAAAGAAGGCTGCTGACGC
TTTGTTGTTGAAGGTTAACCAAATCGGTACCTTGTCTGAATCCATCAAGGCTGCTCAAGA
CTCTTTCGCTGCCAACTGGGGTGTTATGGTTTCCCACAGATCTGGTGAAACTGAAGACAC
TTTCATTGCTGACTTGGTTGTCGGTTTGAGAACTGGTCAAATCAAGACTGGTGCTCCAGC
TAGATCCGAAAGATTGGCTAAGTTGAACCAATTGTTGAGAATCGAAGAAGAATTGGGTGA
CAAGGCTGTCTACGCCGGTGAAAACTTCCACCACGGTGACAAGTTGTAAAGTGCTTTTAA
CTAAGAATTATTAGTCTTTTCTGCTTATTTTTTCATCATAGTTTAGAACACTTTATATTA
ACGAATAGTTTATGAATCTATTTAGGTTTAAAAATTGATACAGTTTTATAAGTTACTTTT
TCAAAGACTCGTGCTGTCTATTGCATAATGCACTGGAAGGGGAAAAAAAAGGTGCACACG
CGTGGCTTTTTCTTGAATTTGCAGTTTGAAAAATAACTAC
Chr coordinates Chr VIII from 452872-453441
w3c xhtml validator w3c css validator