Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FMO1
Systematic Name YHR176W
Strain S288c
Description Flavin-containing monooxygenase, localized to the cytoplasmic face of the ER membrane; catalyzes oxidation of biological thiols to maintain the ER redox buffer ratio for correct folding of disulfide-bonded proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FMO1 YHR176W
AGATCTCTGACCAAGATCAACCAAGCCGACAAAGTGTCCAATAGTATTCTATATGGTTTG
CAAGTGGGATTCTCATTCATGCTCATGCTTGTATTCATGACTTATAATGGTTGGTTAATG
TTAGCTGTCGTGTGTGGGGCAATATGGGGTAATTACAGCTGGTGTACTTCGTATAGTCCT
GAGATAGATGACAGCTCCCTCGCCTGCCATTAAGATGGTGACAAATATTACAAATTTGAT
ACTATTTGTATCTATTTTGTTTTTATCCGGGATTTTTCGTATTTCTTCCTCATTCATACC
CTTCCCTTTATTTGTTCCCACTGAGTATAATGATAAACTACGTTAACATTACATGTATAA
TATTTAGCACTCGTACGTTACTAGTCTTTGACACAAGTTTATATATCCCCCCCTTTATGT
TATCGTTTATTGGCTACAGCCTCAGTAATCAAAATAGTCCACTATTTCTATATCATTAAC
TTCTGCGTCGCCAAGATGTTAATCATGAAACGATCTAGTTCTTCAACAGTTTGCCAGCGA
CCATTCGAGCTAATCTTGAACAAAAGTAATACTATTTAAGGGTGGGCGCGGGTTGTTATA
CCGTTTTGAGACGATCTACTATAACGTTATATTTAATTATATAAGTGATGAATTTAATGT
CCCGTCCACAACACGAAATCGCACCTCATTTCAACGCGGCAAGTATTAATGTTCTGCTTT
ATGAAAGATTCCATGAACCCTTTTCTACCTTTTAAATTCCTCTTTTCACTCTTAATCACA
TGATATTACCTTTACATAGGAAGCGCCAGACATCTTTTTGCCGAGAAAAGCCATTATGCA
AGATAATCCTGTAGCCTCATATCAAGGATAAATGCCACTGCAAAAACGCAGTCGTTATTT
GGGACTGTATTTAAATGGGCCACTGTTTTTATACAAGTCGAAAATACAATAATACAGAAA
ATTCAAGCAGGAAGCGAGAAATAACAAGAAGTAACTAGGC
Chr coordinates Chr VIII from 454229-455527
w3c xhtml validator w3c css validator