Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OYE2
Systematic Name YHR179W
Strain S288c
Description Conserved NADPH oxidoreductase containing flavin mononucleotide (FMN); responsible for geraniol reduction into citronellol during fermentation; homologous to Oye3p with different ligand binding and catalytic properties; may be involved in sterol metabolism, oxidative stress response, and programmed cell death; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OYE2 YHR179W
ACGTCTCTTGGGTTGATAAACTTGTATGACATATGTTCACCGAGTTTTGTCATGTCGTCA
TACTATACGGCAGCGGCTTGTTGCTGCCGTTTAATGAAACAGTTTTTTTCACGACAAGAT
TCTTCTATTGATTATTCACATATGTATTTTAATGAAAAATGAGTACTTTATAACACAACC
CTAATGACAAATGAAAAAGTTGATTGCCATGAACTCTTAAAGCGATTTATGAGAACAATT
AATTGATTATATATATATATCTTTGCAATTATGTCGTTTGTTGCAAGATGCTTCTGAAAG
TAAGTAACTCTATAAGATAGATAATGCTACAAGACGCCAAACGCAAGTGAGTAAGAAATA
AGAGCTGGCAGGTCTTCGCCGGAACACTATCATCAAAATCACTACAATTTAGCGGCTTAG
CACAATACGCGTTTTCAACTTCCTACGCTAGCGATGACAAAATGTCTCCAAGAGGCGGAA
CTTGCGACGGATGCATGGAAATATCTTACGTAATGAACTTCCGTAATGAACTTCCGTAAT
TCAAGATCTCTTAGCATCTCTTGTTCAATCTTCAGACTCTACTAAGTGTTCTTACCAACC
ATTGGATGCTCATTACAAATGAATGAATATATTGCACGGAACGGAAGCGGCATGCTTTTT
CCGTCTCGTGTGCTTAGTAAAGCAAAACGGAGTAGAATCGGTAAGAACTTCCTTTTTGGG
TTGGAAAATCATTGCCATTGTTTGGACACCTTTCTTTTTCCGTATTGTTCGAGCACCGCG
TTTCTTTTTGGGTACTTGATGAGGTAGCAGATTCCTGGAACGTGCTTTCTCTCGAGGTAA
CCTGCCTTGTTCCTCCTGGTGACTTTCTAAAATATAAAAGGAAAAGCATATCTCTAGTTT
CGAGTTTTTTCTTCATACTTTATTTCCTTATGTTAAACGGTCCAGATATAGAATAAATCA
TCATATTAAGCTAAATATAGACGATAATATAGTATCGATA
Chr coordinates Chr VIII from 462502-463704
w3c xhtml validator w3c css validator