Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SSP1
Systematic Name YHR184W
Alias SPO3
Strain S288c
Description Protein involved in the control of meiotic nuclear division and coordination of meiosis with spore formation; transcription is induced midway through meiosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SSP1 YHR184W
GTAAGTGGACTGCCATCAACGCCTTGGATTTGGGTATGCCAGTTACTTTGATTGGTGAAG
CTGTCTTTGCCCGTTGTCTATCTGCTTTGAAGAACGAGAGAATTAGAGCCTCCAAGGTCT
TACCAGGCCCAGAAGTTCCAAAAGACGCCGTCAAGGACAGAGAACAATTTGTCGATGATT
TGGAACAAGCTTTGTATGCTTCCAAGATTATTTCTTACGCTCAAGGTTTCATGTTGATCC
GTGAAGCTGCTGCTACTTATGGCTGGAAACTAAACAACCCTGCCATCGCTTTGATGTGGA
GAGGTGGTTGTATCATTAGATCTGTTTTCTTGGGTCAAATCACAAAGGCCTACAGAGAAG
AACCAGATTTGGAAAACTTGTTGTTCAACAAGTTCTTCGCTGATGCCGTCACCAAGGCTC
AATCTGGTTGGAGAAAGTCAATTGCGTTGGCTACCACCTACGGTATCCCAACACCAGCCT
TTTCCACCGCTTTGTCTTTCTACGATGGGTACAGATCTGAAAGATTGCCAGCCAACTTAC
TACAAGCTCAACGTGACTACTTTGGTGCTCACACTTTCAGAGTGTTGCCAGAATGTGCTT
CTGACAACTTGCCAGTAGACAAGGATATCCATATCAACTGGACTGGCCACGGTGGTAATG
TTTCTTCCTCTACATACCAAGCTTAAAGGAAATCTCCAACCTGGACATAAACCAAAAAAA
TTTAATGAAATAGATTAGTTATAGTAAAAGTAATCATAATAATAAATAGATAAATAAATC
CAAATGCAATTATAAATAGTATATGAAGTTATGTGTTTTCTAAAATATTAAAGGTTTATA
AACGGGGTCCCGAAACTATCTCCATTTCTTTTTTTTTTTTTACGTAAGGAAAGGCAAACA
GGCGACACAAAATCATGAAGTCAGAAAATAAAATAAAAGTGAAAAATTTCACAATAGTGC
CTATTATCATGATAGAAGTAGAGTAGAAAAGCTAGCAACA
Chr coordinates Chr VIII from 472744-474459
w3c xhtml validator w3c css validator