Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IKI1
Systematic Name YHR187W
Alias ELP5, HAP2, TOT5
Strain S288c
Description Subunit of Elongator complex, which is required for modification of wobble nucleosides in tRNA; iki1 mutations confer resistance to the K. lactis toxin zymocin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IKI1 YHR187W
ATATTTTCAGCACTGTTGCAATCATAGACAAATATACATGGCGCACCTAACCAAGTTTGC
AGGTCATACAAAGATACCGGAATATATTGTGTATAACCTCTGTTGAAAACCCAAATTTCA
CCTGATTTTGTAGGCTTAGGCACACCATGTCCGTTGTAGTGGAAAAGTATCCTATCTTCC
TTAGAAGTTCTTCTTAGCGAGTTGCAAAACCGTTTGACATCCTCTACACAAGGATCCAAG
CTTTGTTTATAGCGTGTTCTCAAAGACAGAGTTTCGTACTGTGCTTGTAAGTTTTTACCA
ATTTGTTCTATTGCTTTCTTCGAGTCCTGGAAATTCAATGGGTCTACCCATGCTTCAACT
CTGGCACAGGGATGTGTCTTCATAACATCAGGGGGATCGACACCTAAATTCAAGCATAAT
AAAAGGGCCGCACTTACTGTCTTCTGTCGATCTTTCATAATCTTCCAATCGGTAATCGGC
TGGTAATAACGATTTACATCTCGTTGTTTATCCTCTTCAGGAATCGGATTTCCATTAGTT
TTGTGTCGTTTATCATCAAAGTAGAATATGAAATCATTCGCGAGTGATTGTAAAAGTTGG
TCACTTTGGTATTGCTCTTCAAACCCATGTCTCATCACCGTATTGAGTGGCTTTAATGGC
TGAGGTCCATAAATCTCCGGCATTATGTATCTTTTACCCTTCTCTGCATGCAATAGGATT
CGCTAAATGTAATCAAAGGAATCTACAAACCAAATGCATTCGAAAATAACTTTACAAGTT
TTAAAATCCTCTATATACTTATGTAAAGTACTACCTATTGATGATTTATTAAAGTATTTT
TGATACTATTAATGCTGCCTTGATTATCATCTCATAGTGCGGGTCACCTTGAAAAATCCA
AATATAAGAAGCGATGCCATTATAACCTCTGGAGAATGATAACTTAAGAGCTTTTTAATA
GCTCCAACCCAAGCTATTGCTACAGGTAGAACAAGATATA
Chr coordinates Chr VIII from 480990-481919
w3c xhtml validator w3c css validator