Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PTH1
Systematic Name YHR189W
Alias PTH
Strain S288c
Description One of two (see also PTH2) mitochondrially-localized peptidyl-tRNA hydrolases; dispensable for respiratory growth on rich medium, but required for respiratory growth on minimal medium
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PTH1 YHR189W
GGAGGGAACGTGTGTTACCATTTCTATGCGTGCGTCCATCTCGTAGTGACAAAGAGCATC
TTCATCTTCAGAACAAATAGTGGCAATATCCAAGGAAATACTATTCCATAGAGAGTCGAA
CAATTTATGACCATCCAAGAGAGATGTCAAACCGGATTTGCCCCTAGTAGGCAATAGTTT
TATGAACGGCGTCAAGTTCTCGGTACAGATGGGTTCATTGGGCAACGATGCTCGCATCAG
GTACAGTTTCTCGGTGCTATTGAAAAGAGGAGCTCCTATATCAGAAGCATATGACCGCCG
GGGAAAGGTCGTCCTTGACTCGTCGATAAAATTTAAAGAAGAACAAAACAATCCGCTCAA
TGAATTGGACAGTTTTTTCCAATTATGGAACGCCTGTTCCTGATCCATGGCCTGCACTTG
CGACCACAATTCCACACCTGAGGCACCTGCCTCTTTTCCAGCATGTGGCAACTGTCCCCA
CGACAGGGCATCCCAGAATCCTCTGGTAAATCTTAAATGAAACTGACGCGTGGCAGTAGA
TTCCAACAATGGTGGGATGGCCCGTGGGAAAGTCGTGTAGTGCTCATACGCATCATATGA
CATGGATGATACGGCCGGGTCAAACGGTTCCGATTGCAGTTGGAATGCAAATGAGAGTAG
CAGATCATTGTTGGGCAGCGGCTTCAACACCAGTGCTTCGTCGTACGGATACCATAAACT
GTCATTTATACCAATCTGCGACACCGTGTCTTCTGCGAACACACCCAGTAGTAGAGTGCC
CAGCATGAAATAGGCCAGTGTGAGGATCATCGTCGTCTTGCCTATGCTTTGTTTGCTTTG
AACACTTGTTTCCGCTCTCCTTTTACTTATTGGCTACTAAAACTACGTGTAAAAGATCGC
CCAGCGCAAAAAGGTCCGGCGGTTTCAAATAATCTCGAACTATTCCTATAATATGCAAAA
TAGTAGGTAGGAACAAGTCGACTCTAGGCAGATAAGGAAG
Chr coordinates Chr VIII from 484028-484600
w3c xhtml validator w3c css validator