Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NVJ1
Systematic Name YHR195W
Alias VAB36
Strain S288c
Description Nuclear envelope protein, anchored to the nuclear inner membrane, that interacts with the vacuolar membrane protein Vac8p to promote formation of nucleus-vacuole junctions during piecemeal microautophagy of the nucleus (PMN)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NVJ1 YHR195W
CCACGCTGCTATGGAAGCAAATGACAAGGTTTAGGGTAGACAATCTCGACATCGATCACC
TGAACGCCGGTATCGAAGGACCCTTTGGATGGATCAACGAAGGTCGCGTGAACATGATTG
GCGACGTTCTTTTACCAGATGACGATGCCGCGTCTGACTCGCTGCAACTGACAGAAATCC
TCACAGAGATCGGTGACCGCTTAATCAAAAAAGCGAAAAGGTACACTTCATCCCTTCCTC
TGGTTGGGCCAGGATTCTCCCCGGCCGTTGATGAAATTGACCCGAACGACTACTTTATTA
TGGACTTTTCTTTAAGACTATACAATGTCAAAGCCGAAGTCCCTCTGTTCACTTCTGGCT
TAACGTATATCAATAGTGCATTGATAAGGCCTATTGTCGGGTACATCAATTCTCACAGGA
CATACATCCCAATCAAATGCCGCATTGTAAAGAAAAAGTCTGATTTTGAGGGCTCCTGGA
CCATATATGATTCATACCTTATGCGGGATCTAAGTGCGGAAGCGTACGATGCCTTCGCCG
ACTACGTCGCTGACGATGAAAAGAGGACATTACGCTTGAGAAGGGTGGGCTTTTGGTCAC
TGCAACTTATACTCCAGGTGATTTTGATGAGTCTCGGTGCTATCGCGTGAGGAATACCTA
CTCCTGTCACTTTCTGTACATATGCATTTACATAGCATCGTTCTTTCTATCAGTTTATCT
AATTTGTGACGCATCTTTCTTCTTTCTACACTGCGGAAAATCCTATTTGAAAAAAAATAG
ACGAAAAATATCAGGACCCACCCCCTTATGAAGGAGAGAAGGGGAAGAGGAGCTGCAAAA
CAAAAAGGTGAGGCTTCTTCTGTCCAGATTTTTGTGAGTGAGAGAGTGTGTGGGAAGAGA
AGGAATTAAACCAAACAAAAATTGGAACCAACAACTGTTGCGTTTGCGTGTGTGCATAAT
ATCAAAAAAGCTACAAATATAATTGTAAAATATAATAAGC
Chr coordinates Chr VIII from 490747-491712
w3c xhtml validator w3c css validator