Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UTP9
Systematic Name YHR196W
Strain S288c
Description Nucleolar protein, component of the small subunit (SSU) processome containing the U3 snoRNA that is involved in processing of pre-18S rRNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UTP9 YHR196W
AGGCTTTAACTGCGGAACAACCCGACGCTGGTGAACTGAGCTGGCGTAAAGTATTTAATT
TCATTTCCAGACAATCCAGCGAATTGGACACACGAATATACGTTCTTATACTACTCCTAT
CCTTTCTACTACCTATCGCGTGGACTGTACTGGACGGTGATCGCGAGACCACGCTAGAAG
ATAAGGATAACGATTGTAATGTAGATCTTATTGAAAACGAAAGGAGGCTGAAGCATTACA
ACGATGGTGAAAGAGCAGTATTGCAATTTGGTAAAAATAGATCCGAACCTATTATATTAA
GCTATAAGGACATGAACGTTTTGGAAGGGGAACATGAGTTTACCTCCAAAGAGGAACACA
GTAACAGCCATTTGACAAGCAAGAGCGAAAATGCACTAAACCAAGTAGGGAGTGAAGATT
TGTTAGGTTGTCACCTGGAAAAGCAATTGGAAGAAGACAAAAATGAACCGAATGGAGAAG
CAGACGGTGAGGATGATAATAACCGGGAAAAGGATTGCAGCTCCAGTTCAGAAGTTGAGT
CGCAGAGTAAATGCCGAAAGGAAAGTACTGCAGAGCCTGACTCTCTCTCACGGGATACCA
GAACAACCTCTTCCCTTAAATCAAGTACATCATTCCCCATATCATTCAAGGGCTCGATAG
ACCTTAAGTCGTTAAACCAGCCTTCATCATTGTTGCATATACAAGTATCTCCCACAAAAT
CTAGTAATCTAGATGCACAAGTGAACACTGAACAAGCATACTCTCAACCATTTAGATACT
AATGTACTATATTTCCGTCATCTCGGTTATCATCGTCACTTACAACGAGGTGCGAAAATT
TTTTTCTTCTAAAGGTGAGAAGAAAACATGAAAAATTTTGAAAAATTTAACGATGAGATG
GAGTTTTCAAGTAACTTTATGTAGTTGAAATACATATTAGTACTCCGTTGCAATATATAA
CGCCGGGCATTCTCCACGTATATACATACCGTAGTGCACA
Chr coordinates Chr VIII from 491931-493658
w3c xhtml validator w3c css validator