Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPN10
Systematic Name YHR200W
Alias MCB1, SUN1
Strain S288c
Description Non-ATPase base subunit of the 19S regulatory particle (RP) of the 26S proteasome; N-terminus plays a role in maintaining the structural integrity of the RP; binds selectively to polyubiquitin chains; homolog of the mammalian S5a protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPN10 YHR200W
TTGAAAGTGATCGATGAGACACAACGTACACCCTTACCAATCAGCTCATATTGCGTGGAG
AAGGGCCACTGTGGGGGGCCCATCTTCTTAGGGAACGCAGAGATGGATGCGTCCACTGCA
ACGCTGGTGGCATCCGCCTTTTTGATCTGGGAATCGTCATACCATTTCTTCGCGAATATG
GATGCCAGTGCTAACCCTGTTAACACAGGCACTACTTTGCTGCCCTTCTTGTTCACACGA
GCATTGCCCGCTGTAGTAGAGTAGTGAGAATACCATTGTGGGGCCCTCCTCATACCTACC
TCTAGGCAATTTGTTTTCACCAAAACTTTACTGATTAAACGCATGTTTCCATATACCTGG
CCTTCTGCTAAGTAGACATGTATTCAACAAGGGGATGTAACCACACGCTGCTTTAATACC
AACAAATCGGCCGCTGATTAGTAATAGGTGCATCATTGCGAATACCGAGAAAGGGTCCAT
TATACGAACTAATCATTCTATACGGCGTCCTTCCTGTTCAAGCACCTCTCTGATTAGTTC
CTTTGATTGAGGCGCTGATGTTGCATCAGGCTGCTGGAGCAGATTTAGTTTCTTTAACGT
CTCCTCTTTAATATTTTCGATCAGTTTTTCTGTTGTTTCCACTGAGGTTGTGTTAGTAAT
TAGTGCGGGTGAAGGTTGGGGGTAGAGTGTTGCGGTGAGGTGACATACGTTCCAGCTGCA
TTCGATGTAGTATTGCGCTGCGCAACTTCTGCCGTTCTTCGGGAGTGAGAGCCGGTATCA
TCGTAACCGAGTGCGGCAGCTGCCCTTTTGCTGATGTTGTTGCCACTTCTTGTTTACAAT
TGTATTCTCTTGAAGTTATATGGCATTATAGCTGCCGGGTTATTTCCGCCAGGCGGGTTT
TCGCCACCGGAATTTACAACTAAATACACACTTATATCAGACTTTTAAAGCGTAAAGAAA
GAAGGGAAAAGTCAATAAATAACTCAGCAGTAACCGCACA
Chr coordinates Chr VIII from 499079-499885
w3c xhtml validator w3c css validator