Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS4B
Systematic Name YHR203C
Alias eS4, rp5, S4B, S4e, S7B, YS6
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; identical to Rps4Ap and has similarity to rat S4 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS4B YHR203C
TTTCTCTTCTTAGGAACGCATGAAATGGGTTTTACCTCATCATATGGATACCCATGCTCT
AAATAATTGTCGAAGCCGAAATAAAACAGCTCCTTCACTTCCTGCTTGTAAGCCTTAAGT
TCTTTAGAAGTGAATGAGTACGCATCGTCTTCGCATGCTACATGATCGAGATGAAGCAAC
AATGCTAGAAGCACCCATAAGCAGCAAACCATTCTATTTCCCTGAATGTAACCAATCCAT
GGAAATATGAAATTATCATGGTTACTCTTGACCCATTAATACATATTCAAAAACGCGTCC
TTCTTTATTGCTTATTATTAATAGTCGCTGAAACACGCCAGAAATAAATCGTTACCCGTC
GTTAAAGCACAACGGAAACCTATCAGTCTATACCAAATGTACTAATAGTGTAACCATGGT
GAGATAGAGTCGCCAGTGAAACTAACATTGAGCAGTGCTTGCTTTTCAGCCTGTTTTATG
GTTATTCTCTTTAAACAATTATTTTCGAGACAATTATGCATCCATACATTTCACCCAGAC
ATTTTGTGTGCGCGTTATTGCGCTTTTTGCAGGGCGCATCTCCTTTTTTTCTATTTTTTC
AGGCTAGTCAGTGTCACACAGCGTTTTTCCGTCAAGGAGATTATCCTACCGCGTAATTTT
CTATTGTTCCTGGGCTGGTCTTTCTAGCATTCCTCGCTGGCGCTTCACTAATCCAGCGTA
GAATCCAGCTTCGCTCTTGCTTCGTCACCTGCCCCGAATGGTGAGGAAAGTTCCTCTTGG
TCTTGGGATTTGCCAAACTAAGTGGTTGTGTGGAGGATCCATGTGGTTTCGTTAGCGCAA
TGGCATCGTATCTTCCTTCTCTAGGATTTGGAGCTGCTTCAAGTCGCTTTGTTTTATTAT
CGGTAGAGTTAATAGTAGTGATATTGTAAGATTTAGAATAGTTTCTTTTTCATATAACGT
CGACTAAGTATAACAATAGATACACCACTATTGAGGAAAG
Chr coordinates Chr VIII from 505247-504476,505530-505517
w3c xhtml validator w3c css validator