Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SET5
Systematic Name YHR207C
Strain S288c
Description Methyltransferase involved in methylation of histone H4 Lys5, -8, -12; S-adenosylmethionine-dependent; zinc-finger protein, contains one canonical and two unusual fingers in unusual arrangements; deletion enhances replication of positive-strand RNA virus
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SET5 YHR207C
TTTATTCTAACGAAAACATGTAGTTGTTACCACTAGCTCTCTTTATAGTGCCATTTTTTT
CAGATGCTTTTTTTTTTTCAAAGCTTAAAGGCCGGTACCGGCAAACACAATAGAATTTTG
AGTCATAAGAAGGCAATATGGATCGGATGGGCCATTAAACAAAAAGAGAGCCAATTCATC
AGTAATAATAGCGACAGCCGGTATGAAATCTGCACAAAGTATCAACCGCCTGGCCTCTAT
CAGTAAGATCATTCAATCAACCGTACACGCGGTACTTATCCAGCGTTAACATTTACGCTT
TACAGTTCAGCTAAAAAAGAACACATTATCTAGTTAATGCCTGGGAAGGCCCTGGCAAGA
TACACTTTATCTAAATTATCTACTGCTCGCAAGGCAATGCTATCAATTTGAGAAGTGCAG
AAGGAAATGCCATCAAGCTTGTGGTGCGCATTTCACTTTTAAGGATAATAACAGAATTTA
ATGGCTTGATATGGACGGGCGGTTTGCGAGCCTTACTATTGATAGGAGTATTCGTCAAGT
CCAGGGCGCCAATGTGACTTATCGCGCTGTGGGTGGGTAATTCTACCTCAGTTTGCTTCT
CGAGGAGTTTGTAGCATAAATCTCGTTAGAATAGTCAAACATACGGTATCTTTCTTTCTC
TTGAAAAATTAGTACAGTCTACAAGTTTTCCTCATTGGCTTTCAGACGAGCATTTGATTG
TCAAGTACTTTCCGGACCACCTGCGATAGTTTCCCTTGTCTACTTGAGCAGATATGCTCT
TACTGACTAGCAAGAATGATAACAAATTTTATCAGTAAACCCTTTCCTTGCCGTAATTTT
TTTTATTTTAGCTTCGTAATTTTTTTTTTCGTATTATTTTTCTTTTTCTTTTTCTTTCTT
GATATCATAATCATGGGGAACTTCTCCATATAACAATAGAAGCTAAATAGGTAAATAACC
AAGCGTGCACTGATACAAAATAACGAAAAGTGGCACAAAA
Chr coordinates Chr VIII from 516485-514905
w3c xhtml validator w3c css validator