Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR210C
Systematic Name YHR210C
Strain S288c
Description Putative protein of unknown function; non-essential gene; highly expressed under anaeorbic conditions; sequence similarity to aldose 1-epimerases such as GAL10
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR210C YHR210C
CATAAAACTGTAAGAATTGTAAAGCAAAACTGGTGCACTGCTACATCAACTCTTATCTTC
TTGCATATAAATTTAAATGAAAAGGAACTACTTTGTAATTATCGATATTACATTGAAACC
TATGAGGAAGATTATGACATGATAACACTAAACTATTGCTGGCCAGCACCCGAACCGAGT
GTCCAAATTGAGTTTTGAATCAGTTTTCAGCTCAGAACAGATTCCCCTTTTCCTTTATTA
GGTCGTATCATCATTCTATGTGCAACTACTGCAGCATTTGCGTATAATTATGGAAATAAA
ATTATACGAAAGTTGATACTTGGTTGTAAATGGCCTAAGAATCGGAAAAAATGGAATTCT
ATTGGCATGCTATCTTGTTTAATGAGATTATGAAGTTGAATATCATTTCTGCGTTTTGCA
TTCAAACAATATCATTTCAAAGGCCTATCGCTGTGAGCAATACGCTGGATTTGCTCATCG
CACAGTAAGCCTGCACTACCCCACCAAATTACAAGAATATAGTAGAGATCAGAAGCTTAT
GAGAAGTCACTTCCAAAATTCGCGTTGTCCAACATCCTTGGAATAATTTTTCCTCCTTAT
GCATCCAGGTGATTGACACTTTTTGACGGGATAAATGCAGGTGGAGGTGGGGGAGGGGTA
AAGTTTCGTAAAGAGTGTCAGGTCGCATATCTTTGCACTGCGCAGAAATTCTCGCAGAAA
ATTACGCTACGGAGAAATTCTCGGGCACTAATATCGTACAAAAATTAGGTTTGTTACGTG
ATAATATGGCCTTGTACCTGTTAAGTTTTTCCGACAATTAGTTACTAGCTGAATATCTTA
AAAAAAGGTAAAAGTAACTCCTCCATGGTTTGGTTATTCATGCGTAAACACCTTGGATGC
TCTGAGATATAAAATCAGAATGTACTACGAAGTACTGGAACTCAATTGTACATTATGTTA
CTGCAATAAGTAAATTCACCTAAAAAGCCAAAAAGTGATA
Chr coordinates Chr VIII from 521737-520712
w3c xhtml validator w3c css validator