Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FLO5
Systematic Name YHR211W
Strain S288c
Description Lectin-like cell wall protein (flocculin) involved in flocculation, binds to mannose chains on the surface of other cells, confers floc-forming ability that is chymotrypsin resistant but heat labile; similar to Flo1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLO5 YHR211W
CCTCTTTCTTTTTTGTAAAAAATTCTGTTTTTAATAGCCAGTTCTTTAGTGATTACAGGT
AAGAGGGTTTCATATTTTAGAAGTGCAGCCATGATGAAGCACTTTTGCTCATTTATTGCG
AGAAGTTTAATAAGTAGTATGGTTCCATTTTCAAGAATCGAGGCACTGTTCCTTCCCAAC
CTTGGAATCATACTCCGAAAGGATTTCAAGCCGATTTAAATTCACCTGGTAACTTTCCTA
CGGTTTGGCCCAAGGTGATTATAATTAACTTGCGGCTTGTTTTCAGCCTGCGATCGAACC
TTTTTTACGCAAAAAAACCTTATTAATTAAGGTTTTGAAAATTTTCTTCTTTCCGGGAGA
TTTTCATGTAGCCTCGAGCTTCTGGATTCTCACGGGATTATCTCGCGTTACATTTTTTAC
TTTCTTCTTTCTTTTTGACTTAGGATATACAGATGATACGTCATTGTGTCATAAAACCCG
CTGTTGTGCAACAAAAGGGAAAAAGAAAAATACTCCTTTTTAGGTCTTATAAATATTTTT
AGCAGCCATCAAGTCCGGCTTTCAAACTTAATTTCACCCTTTTTCACGGCACCCTCGAGA
ATTACACTTTGGTTGCATGCAGGAGTACGCGAAATGCAGCATAAGCTACACATCTATGCG
TAGATCGCTTAACCTCTAAAGGCCGTAAACTTTTATTTTGTTTTGCGCTCATTAAAACCT
AGTGGGAGCTGGTAGGAAATAAGCTAGTAGCTTCTATGGATAGAATGGAAATAAACGTAG
GTGTAAACACTATTGGTAGAGAAGTTCCTCTGGTCAAATTTTCATGGGAGATACGTTAAA
TCTTTCACAGTCTTATCGTTTTGAATCACTGGACGGTTCTGGTATTCTGCTTCATATTTC
GACAAGATAATAAATATAAAAAGAGCACCCTCATGATTTCTTGCTCTGCAGTAAATTCCG
CAAATGATTTTCTTTAAATTGATTAGCACCACTAAAAAAA
Chr coordinates Chr VIII from 525392-528619
w3c xhtml validator w3c css validator