Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR214W
Systematic Name YHR214W
Strain S288c
Description Putative protein of unknown function; predicted to be a glycosylphosphatidylinositol-modified (GPI) protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR214W YHR214W
CGCTTATATATGGGTATGAAACAAGTTCAAGAATTTATAATGGAACCCAAAGGTTCAGTC
TTTGTAGTTCGAGCGACATTGCGCGTTTCCTTAGAAAACGCTGGAAAGATATTCTTTAAC
GAGACGGAGTAATTCTCGTCAGGAATAGGATGTTGATTGATTTTTGCTGTAGTTATATAG
CAGGGACCCACGGAAGAGAGCGAGCGCCTTCTTTCACAGGGACTTTTGTCAGCCACGTCT
CCGCGGAAAACAATTGCCGTCCGCGTCGCAGTGAGATTACGCAGCCGTGCGCTTCAGGGA
CAGAAAAGAAGCATTTCGCGGCTACGGAGAAACAGTGCACTAACTCTCTCGAGGGTAGCC
GCAAAGATTTCTTGTCTCTTCCATTAGGACATAGCTATCTTTTTCTTTTCTGTTTTTGGC
GTATGATCTGTTCTGAGCCAAAGTTATAGAACATTGCTTGAATAAGCACCTCACAGAGTA
GGGATTGTATAGAAAGTAGCTGAGCGTCTGCCCACGTAACAAACAATCTTGCCCCTTCCC
CGCTCTTGTTTTCGCGTGCCTCTTCTACAATAATCTGGCCAGGCTAAATCGCGTTCTGCT
GCTGCTGCTGCTATTGTTATTGTTGTTGTTGTTGTTTTGGCCAATTGCTTATGTGTTGGT
CTGCAAATTAGCACCTCGTTCCCTGTTGGCAAACGCGCGCGTACAAGCCTTACAGGGCTT
GAGAATGTTCTTCGTAGAAATGCATGCACAAAAATTTTGATCTAGCACACCATCGGTCTC
TGTAGCTTCGGGCTCTATAGCTATGGGTTAGGAGTCCGTGAGTAGTAACAAGAAGAAGTA
TATAAAAAGCAGGTAAATCGTACTTCAATATGCTTCATTGTCACTGGATCGTCATATTCA
CTCTTGTTCTCATAATAGCAGTCCAAGTTTTCATCTTTGCAAGCTTTACTATTTCTTTCT
TTTTATTGGTAAACTCTCGCCCATTACAAAAAAAAAAGAG
Chr coordinates Chr VIII from 541651-542262
w3c xhtml validator w3c css validator