Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO12
Systematic Name YHR215W
Alias PHO10
Strain S288c
Description One of three repressible acid phosphatases, a glycoprotein that is transported to the cell surface by the secretory pathway; nearly identical to Pho11p; upregulated by phosphate starvation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO12 YHR215W
TGCTGTGACCGTTTCCAATACGGAAAGAAACGGTACTGGGAGCAGGAGTTGCTTTTACAG
ATATGAACAATGCCAATAGAGCCGCACATGTAATTACTGGTTCACACTCGTGGGGCCCAC
ACGATTCCTGTGCAAAGTTTGACAAGAGGATGGAGTTTCACGTAAATGCTGCCAAAGGTG
ATGCGGTTTTGTTTTTGGGCAGCCTCTACCATGTTGCAAGTGCGAACCATACTGTGGCCA
CATAGATTACAAAAAAAGTCCAGGATATCTTGCAAACCTAGCTTGTTTTGTAAACGACAT
TGAAAAAAGCGTATTAAGGTGAGAAAATCAAGATTATCTAAGCCGATGAAAAATGAAAGG
TATGATTTCAGCCACAAATATATAGTAGTTATTTTATACATCAAGATGAGAAAATAAAGG
GATTTTTTCGTTCTTTTATCATTTTCTCTTTCTCACTTCCGACTACTTCTTATATCTACT
TTCATCGTTTCATTCATCGTGGGTGTCTAATAAAGTTTTAATGACAGAGATAACCTTGAT
AAGCTTTTTCTTATACGCTGTGTCACGTATTTATTAAATTACCACGTTTTCGCATAACAT
TCTGTAGTTCATGTGTACTAAAAAAAAAAAAAAAAAAAGGAAATAGGAAGGAAAGAGTAA
AAAGTTAATAGAAAACAGAACACATCCCTAAACGAAGCCGCACAATCTTGGCGTTCACAC
GTGGGTTTAAAAAGGCAAATTACACAGAATTTCAGACCCTGTTTACCGGAGAGATTCCAT
ATTCCGCACGTCACATTGCCAAATTGGTCATCTCACCAGATATGTTATACCCGTTTTGGA
ATGAGCATAAACAGCGTCGAATTGCCAAGTAAAACGTATATAAGCTCTTACATTTCGATA
GATTCAAGCTCAGTTTCGCCTTGGTTGTAAAGTAGGAAGAAGAAGAAGAAGAAGAGGAAC
AACAACAGCAAAGAGAGCAAGAACATCATCAGAAATACCA
Chr coordinates Chr VIII from 552099-553502
w3c xhtml validator w3c css validator