Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIR3
Systematic Name YIL011W
Alias YIB1
Strain S288c
Description Cell wall mannoprotein; member of Srp1p/Tip1p family of serine-alanine-rich proteins; expressed under anaerobic conditions and required for anaerobic growth; TIR3 has a paralog, TIR2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIR3 YIL011W
GTTCGAGGCCAAACAAAAACCGCAGCACAATGGAGTAAAAGTCGAAGGCACGGGCCCCAA
ACGATAGAGTGGAAGTTGTAGGAAACAAAAGTGGCCGTCTATGTGGCGCTTCTCTGCGGT
GAATTCTGTGCGAAGTGCCTAAACGAAAACGGACGGAGAAGGCTGCGGGGGGATATCCCT
TGCATAAAGGATGCCCGGCACTGTCCTAGACGGTGCCTTCCCTTAGAGACTAGGAGAGAC
TTGAGTAGGAGAAACTGAGCAGGAAAATTCGAGAGATAAAGTACATGTGCCTAGGTAAGC
TGTACTTCGAACAGCTAATATTAGTAAGATGCATAAAGGGGCGTCAAAGTGGAAATATAA
CGACAGGAGAATCTCGGTGTGTAAGTTGGAATGTGTATTGCACCACTTCCATGATTGGGC
TTTTTTCCTGGCGCAAAATGTTGCTTTTTCAACATTTTTCTTATACGCAGAGAGAGAATC
GTCAGATAGGTGGTAAAACTTGGAGCCTAATTAGCTCATTATTTCATTTGAACGAGACAT
TGGCTTCTGCCCTACATCACCCATACGAGACATTGGCCTTATACGAGGCGTACTTCGCCT
TGCGGGAAAAAAAATTTCTTTTGTAAGCGAGGTTACTCAGAAACTGTGACTGAAGGCAGA
GGTTGGAAACGTGTGTAGACTCCAAATGGAACGATAGGAACGTGTACCCTACCGCTTCTG
CACACGTTTCTTAGATATGCGTGCCTTAAGGCGACCCATTGTTCCTGTTTACCATGATTT
CTGTAGGCTTTTTTTTAGAAGGCCCTAGAATGGATTGCAGATTTCCGTCTGAGAAGGCAG
TATACGTACATATGAATATATATATACATATATTCTTTGGTGGAGAGTATAAGCGTTTCG
TCTCCTCTTCCTTTCTCTACTGCAGATTTTCTTGCTGGTTGTTTGATTTTTTCTTTTTAG
TGTTCCCCAGATCCAATTGTTCAACCGCCCACACACAACA
Chr coordinates Chr IX from 333727-334536
w3c xhtml validator w3c css validator