Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BAR1
Systematic Name YIL015W
Alias SST1
Strain S288c
Description Aspartyl protease secreted into the periplasmic space of mating type a cells, helps cells find mating partners, cleaves and inactivates alpha factor allowing cells to recover from alpha-factor-induced cell cycle arrest
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BAR1 YIL015W
GCGAACTGACATAACCAGTAGAAAAAAAGATGGAATCAGCTCTGTAGTGCTGGTTTCAAT
CCTGTTTGTTGGTGAAAAAATAGCACCAGAAGGGCAATTGTACGTTTCCGTAATGTCGCA
CAACGCAATGGAACATTGGAAGAGCAAGCTGAGCAAAACAAGTACCTCGACGTACGTCCT
CTTGGCCGTGATTGCTGTTGTATTTTTGGTTACAATCAGAAGACCCAATGGCAGCAAGGG
AAAAAGCAGTAAAAAGAGGGCTTCTAAAAAGAACAAGAAAGGTAAGAATCAGTTTGAAAA
AGCGCCGGTTCCTCTGACTCTAGAAGAACAAATTGACAATGTGTCGTTGAGATACGGCAA
CGAGTTGGAAGGTCGTAGCAAGGATCTAATAAACAGATTTGATGTGGAAGATGAAAAGGA
CATCTACGAGCGTAACTATTGCAACGAAATGCTTTTGAAGTTGCTGATTGAGTTAGACAG
TATCGATTTGATTAACGTGGATGAGTCCTTAAGAAGGCCGTTGAAGGAAAAAAGGAAAGG
CGTCATAAAGGAAATTCAGGCTATGTTAAAAAGTTTGGACTCTCTTAAATAAGTTTGTAT
TTTTAGTTTATAGATAACGGCTCTTGCCGAATTCATAGGCTGCACTCATTCCGGTACGGT
ACACATTTGTTGCATTTATTATATTAGAGATGCGTTGTCCCTGTTTTTCTACCTCCGACA
TCATGCTGAAACATGGCATGTAATTACCGTAAAAGGAAATTACATGGCGAGTGTCACATA
ATAGCGACAATAACATGTATACACAGCCAGCTATTCTGAAACACACCACATTATAGTTAT
TGAATGTGTGTGTTTTTTGATAACAGTATAAAAGTGAAGAGAAAGCACGTCGAGCCTTGT
CATGATGAATTCTTTAATGATCTTCGCGTGATTTAATTCTAGTGGTTCGTATCGCCTAAA
ATCATACCAAAATAAAAAGAGTGTCTAGAAGGGTCATATA
Chr coordinates Chr IX from 322342-324105
w3c xhtml validator w3c css validator