Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FAF1
Systematic Name YIL019W
Strain S288c
Description Protein required for pre-rRNA processing and 40S ribosomal subunit assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FAF1 YIL019W
AATATATCTAAGGAACTACCGAATGTCAAATCTACTTTTCCGTGACTTAGTTCGTCTACT
AATTTCAAATCATCAACACTTTTGGCCCCACCAGCATAAACGATTTTCAAATCATCGTAA
TCTTTGGTCCATTCGAAAAGCTTAGAAACCAATAATTCATCGATACCACCACACAAACCT
TCAACGTCTGCAGCGTGAATTAGAAACTCATTTGTATATTTCCTCAATTCTCTGAAAGTG
TCAGCATTAAGCTCAAGATCAGTTAGAGTTTGCCATTTGTTCATGGCCACAATCCAACGA
CCGTCCTGGGTTTTTCTACAGCTTAAGTCTACAACAATGCGGTCTTTCCCACATAGTTCT
GTCAGTCTTTCTAACCTTTTTAATTGAAAATGACCCTCTTTTGTAAATAGCCAACTCGTA
ACAATTACTTTACTGGCCCATTTTAACCATTCCAAACAGTTCGTATCATTAATTCCTCCG
CCCACTTGTAGAAATTGTGGTGACTCCTGGAGTGCCTCGCGTGCAGCGTCGTCATTGTTA
GGTCCCAACTTAATAACATGACATCCTTGGACATCTCTGTCTTTGTAAAGTTTAGCGTAA
TATGAAGAAGGATGTTGTGATACAAAGTTAGTTTTTGGAACGTCCTCCTTTTTGCTCGTT
AACGTTCCACCTACAATCTGTTTAACCTCTCCATTATGCAGGTCTATACAACCAATAAAC
TTCGTCATTTTTTTCTAGTATATACCCCCAGCCTTCTTATGCGCAGTTTCGAAGATATTG
TGAATTTGCAGGCGAGGATTCTCAAATTATTCCGTATGACTCTGCACACTAGACATGGCT
CAATCTTGGCAATGGACCCTGTGCTGAATTTTCGTCATTCGTCTCATGCGACCGTTCCGT
TCCTAGAAAAATTTTGAGCGATGAGATGAGTATACATTAACGATGGCAGGAACAGTTATA
ACAATATTGAGAGTACAAATGACCCAAAAGCCATAAAAAG
Chr coordinates Chr IX from 315093-316133
w3c xhtml validator w3c css validator