Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIL024C
Systematic Name YIL024C
Strain S288c
Description Putative protein of unknown function; non-essential gene; expression directly regulated by the metabolic and meiotic transcriptional regulator Ume6p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIL024C YIL024C
TTTGTTCCTGGACTGCGCAAGAACGATCGTGCCAGCTTGACACTGTCCTTACTAGTTTCC
TTTTCTCTAGGAACACTCCTGGGTGATATTTTATTACACGTGATACCTGAAAGTCTCAGC
GGCGTAACTGATGTCACAATGGTTGGAGGAGCCATATTTCTGGGGTTTATAAGCTTCTTG
ACTCTGGATAAAACGATGCGTATTCTGTCAGGGACGTCCAACGATGACGGCAGCATACAT
TCTCATTCTCATAGTCATACTCCACAACAAACTGCAGAGAAGAAAGCGGGCTTTAACATG
TCTGCGTATCTGAATGTCATATCCGGCATTGCTCATCACATCACGGATGGCATAGCGCTG
GCTACGTCATTCTATAGTTCCACACAAGTTGGCATAATGACCAGCATAGCTGTCACTTTC
CATGAGATCCCTCATGAGCTAGGTGACTTCGCCATTCTGCTTTCCAGTGGGTTTACGTTC
CCACAAGCGATAAGAGCCCAAGCGGTGACAGCTTTCGGCGCCGTCGTTGGAACGTCCATT
GGCTGCTGGATGAACGAAATCGGGAACAACAGCCATAAAGCAACGTCTTCATCCGCGAAC
GCATCTGAACTTATGCTGCCGTTCACGGCGGGCGGCCTCATATACATAGCCACTACTAGC
GTTGTACCGCAGATCTTACATAGCTCCGCACCCGATAGCAAGCTTCGAGAGTTTAAGAAG
TGGGCCTTGCAGCTAGTCTTCATTTTTGTAGGATTTGCCGTTATGGCGCTCATGGATGAG
CATTGATTCAGCTTTGTATTACTTGGCGTGCAATATACGTACCTTTATAGTAAATATCCT
TGTTGCCTTATATGGTACCGACGCTTCCCCGGATTTCAATTAAGGCAAAAACAGGCGATA
ATCAGATCAGATCAAACATTTATCTCTGACCTAATACAAAAAAGAAACACAAACAAGAAC
AGTATTGATCGGTTTAAAGGCGTGCACAACTGTTTTAAAG
Chr coordinates Chr IX from 309171-308602
w3c xhtml validator w3c css validator