Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRM2
Systematic Name YIL037C
Strain S288c
Description Pheromone-regulated protein, predicted to have 4 transmembrane segments and a coiled coil domain; regulated by Ste12p; required for efficient nuclear fusion
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRM2 YIL037C
TGGGTTTAACAACCCGATCATGCGAATTGACGTTTCCAGCTGCAATAGAATATTGTGGGG
TTAAAGAATTTCTATTGGAAGTAGTATAATCATGTATTTGGTCAACCACACCAGCCATAT
TTGTGCTATAGTTTATGTCAGTAGGATCTAAGGATCTACTTAAAGCAGAATTGTTCATAG
TAGAAGTGGTGGTGGCGGCGGCAGAAGTATCACTAACAGAGTGCGGTATCTTATTATTCA
AGATCTTTGATGTGTCATCAATACCACGTTTATTGTTGTCTTTTTGCTTGTTGGAATTAG
AGTCTACGGAATGATACTCCTGACCAGTAAACATTATCCTACCAAAAAGGTGTGGGCTTA
TACTTTTTTCTTTACTACTTTAGATCTTTTTAGATCCTTTTGAATCTTCCAATTGAAAGA
CTGCTTTAAAAGCGAGTTTTTGATTTAGAAACACCAACAGATACGTATACACGATAACCT
CTATAGCGGTTCTATTTCTGTTAACAAGAAGGTACTTGAAAGTGATAACTCAAAAAACAA
GAGTACAATATGAAAATCTTTTGCCTTCATTGTCATTGTCATTGAATCCCCGATTATCAT
TGTCAGCAATTTCGGAGAAGGGGGCAACTATGTTCCGTGTAAGGTGATATTACTCAAATG
TGTCACAATTTCAACTTCTGGGAATAATATTTATAATAGTTGAGATTATTCTTGATTATA
GAGGCGACAGCTTATCTTAATTTTCGCCAATAGGTTTGGAAGAACATTGGTATTTTCATT
CGGTGCAGCATTTTAATTCAGAATTATAACCGTCCTTGTACGGTTATAACAGCACATTAT
TGAAAAATGTTTTAAAAATGTTTCAGCCCAGTAATAAAACATTTACATATGCTATCTTGG
CCCTTTATATAACATGTAAAGCAAAAAACTAGAACACTAACATGGCTTAAGTAGCTGAAA
ATCTACACCACTTTTCGATAAAACTAAGAGTACGGCAAAG
Chr coordinates Chr IX from 284999-283029
w3c xhtml validator w3c css validator