Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GVP36
Systematic Name YIL041W
Strain S288c
Description BAR domain-containing protein that localizes to both early and late Golgi vesicles; required for adaptation to varying nutrient concentrations, fluid-phase endocytosis, polarization of the actin cytoskeleton, and vacuole biogenesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GVP36 YIL041W
GCACGTGAATGTGATGTCTTGTGATGGCGGGTGAATTAGGACCGGGGTCCGCTGAGTGTT
GAACTTCACAAAGCATATATCATTGACATAATCAGAAACGTGCTTGATCAATTGTGCTAT
GGGGAGGTCCCGGTGCAAGATTCCAATCATCCTTTTGTTCGTGTCACCTTTGTTCTGTGC
CATCAACGACAAATAGTGCGTCACAAGCAGCTTCATCGTGATTCTCTCCTTCAGGTGGAA
GTTCAAGAACTGCGAAATTTGAAACTTTGGGTAACACGATTGGATTTCCTGAAGACCTTT
TGCCAATACCACAATGGCGTCCTCGTGGTCGTCCAGCAGTTCTGTGAACTTGGCCTGTAT
CTTGGGAGGATTGTGCAACTCGTACGGGTATGCGATTGATAGCAACGTTTGCAAGCTTTT
CAAATACAAAGAGTTGGTTCTCTCAATATGAGGGTTGATTACCGCATTATACGGTAGCCT
CTGAATGGCATTAAGCCGTTTACACGTCAATGAAAGCAACAGGTTGATTGTCTTGATCGT
CAGCATGTACTCCTCCTTCTTGGTCAGCGGCGGCCTGTATTGCAGGAAATACTCGTAGTT
TAGGGGCGCAATTGGTTTACTAGCGTAGTCCTGTATCAGCAGCTCAATGTTCGACCTAAT
CTTGTAATGCTGGTCGAACGACAGTTGCGACAGCAGCTCGTGTGAGGGTCGCTGGCGATG
TGCCCAGCGCATTCCCCCACATTTCCATGAACGCATAATCTTCCACATACTACCGTGAAG
GCGTCTTGATACCACGTCTTCCAGTTATGGTCTTGACTCACCAATGTTCTCAGTTTAATG
TTGTTTGCTTCATACTGGCAGACATTTTCCCTTATTACCGTGAGAAGCGAGCGGTGGATT
AATCGGGATGTCAAAAACAAGAAAATTGCAACCTTCTTCACCTATAACCTATATGATTTG
TAGGCAGAGGAGTGGAATAAGCAACAAATCATAGTCATCA
Chr coordinates Chr IX from 276525-277505
w3c xhtml validator w3c css validator