Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET30
Systematic Name YIL046W
Alias ZRG11
Strain S288c
Description F-box protein containing five copies of the WD40 motif; controls cell cycle function, sulfur metabolism, and methionine biosynthesis as part of the ubiquitin ligase complex; interacts with and regulates Met4p, localizes within the nucleus; dissociation of Met30p from SCF complex in response to cadmium stress is regulated by Cdc48p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET30 YIL046W
GTCTGGTATACCGACACAGAGGGCATCCAGCTCCGGTAGGAGCTGGATTGCTCTTCTTCG
GCATCCAGCTTCTCCTTGTAGCGGCGAAGCTTCTTCTTGCCGACCTTATAATCAATATAT
TTGTCCCTCCATTCCGGGATGGCAGACTCGGTTAGATGGTCAGCAAACTTCATCTGATAC
GGTGCTATGGTAAAGCCCTTCCATTGCTGCCAACTGAATTAAAAAAAAAAAAAAAATAAC
TACCAACCATCAAATCAAACAAAACAAAACAAAAAAGCAAAGGAGAAAACCCATCTTGTA
CATGTACAGTCCCAAACTGTTGCGAAACCGTGCGATGATGTTCATGGAACTTGCGTCAAA
TAAAACCGCATCCCGTCCCACGTGACAAACGGCACCCAAAATCCGTTCTAGAAATGCCTC
ACACCCACACCGATGATGGGCTTCCGACTCGATGACTACCAACACATAGCCAGCCGCAGC
GGCTGGCAGCATGTGCATGATAATGATAAGTGATGATGAATGATGGTGATAACGATTTTG
AACAAATGGCTGCAGCGATAGCAACTAAGGGGATGGAAAGACAGATCTGGGAGAGATAAC
TGCAGGGTGTGGCACGGCAACACAAGGCTATTGTATTGCACTAAACGGGCAAGAAGCCAT
GATGTGCGTCTGTATCCCAAAAAAAAAACTAATGGATTGGCGCGTGTACTATATATATTC
ATATGTCGTGTGTTTGTATATGTGTGGGAGTGATTGTGCGTGTATATGTGTGTTGGCGTG
TGTGGTACAATGTGTGTGTTTTAATGTAGAAATGAGGTTGTAGCACGTGATCGGGAAGCC
ACAGTTTGCGCGGAGATATTTTATTTTTTTTCATCAGCGTAAGAAGAAAGCAACCTTGCA
GTCTGTATCGTAAGAGAAGACTGCAGTTAAAGAAGTTTAGAGAAGAGGCTTGAGTATCGG
TAAAGGGGTGTGTGTTTGGTGATTTATAAAGGAGAAGGGC
Chr coordinates Chr IX from 268651-270573
w3c xhtml validator w3c css validator