Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SYG1
Systematic Name YIL047C
Strain S288c
Description Plasma membrane protein of unknown function; truncation and overexpression suppresses lethality of G-alpha protein deficiency
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SYG1 YIL047C
TTACCCGATGATCCTTGTGCCAAATCATCGCTACTGCCCGTAATAAGCAATCTCTTTAAT
GGTGGCATCATCGCCGTATCTGTCATTTCACTGCTGTTATTACTATTACTATTGTCAAGG
TCGTCCTTGTCCTTGTCCTCGAAACTCATCATCCTTTGCCTCTCTCTCCTCATGCCCTTC
TCCTTTATAAATCACCAAACACACACCCCTTTACCGATACTCAAGCCTCTTCTCTAAACT
TCTTTAACTGCAGTCTTCTCTTACGATACAGACTGCAAGGTTGCTTTCTTCTTACGCTGA
TGAAAAAAAATAAAATATCTCCGCGCAAACTGTGGCTTCCCGATCACGTGCTACAACCTC
ATTTCTACATTAAAACACACACATTGTACCACACACGCCAACACACATATACACGCACAA
TCACTCCCACACATATACAAACACACGACATATGAATATATATAGTACACGCGCCAATCC
ATTAGTTTTTTTTTTGGGATACAGACGCACATCATGGCTTCTTGCCCGTTTAGTGCAATA
CAATAGCCTTGTGTTGCCGTGCCACACCCTGCAGTTATCTCTCCCAGATCTGTCTTTCCA
TCCCCTTAGTTGCTATCGCTGCAGCCATTTGTTCAAAATCGTTATCACCATCATTCATCA
TCACTTATCATTATCATGCACATGCTGCCAGCCGCTGCGGCTGGCTATGTGTTGGTAGTC
ATCGAGTCGGAAGCCCATCATCGGTGTGGGTGTGAGGCATTTCTAGAACGGATTTTGGGT
GCCGTTTGTCACGTGGGACGGGATGCGGTTTTATTTGACGCAAGTTCCATGAACATCATC
GCACGGTTTCGCAACAGTTTGGGACTGTACATGTACAAGATGGGTTTTCTCCTTTGCTTT
TTTGTTTTGTTTTGTTTGATTTGATGGTTGGTAGTTATTTTTTTTTTTTTTTTAATTCAG
TTGGCAGCAATGGAAGGGCTTTACCATAGCACCGTATCAG
Chr coordinates Chr IX from 267823-265115
w3c xhtml validator w3c css validator