Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NEO1
Systematic Name YIL048W
Strain S288c
Description Putative aminophospholipid translocase (flippase) involved in endocytosis and vacuolar biogenesis; localizes to endosomes and the Golgi aparatus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NEO1 YIL048W
TGGATCATATTTGGACACTCATTGCGCCGACTTTATGAAACGCTTTATGTACTACATTAT
ACAAGCAATTCTAGGATGAATTGGTCCCATTATCTAGTCGGTATATGGTTCTATTCCGTA
CTCTTGTTAATTCTTAATATATCACTGTACAAGAACTCCATTCCAAATACGTTAAACATG
AATGCTTTCATCATATTCTGCATAGCATCTTGGGATCAGTACAAAAATCATGTTATTCTG
GCCAATCTGGTTAAATATTCGCTGCCAACAGGAAGGCTTTTCAGGTTGGTATGCTGTCCT
CATTATCTCGATGAAATAATCATTTATTCTACTCTGTTGCCCTATGAACAAGAATTTTAC
CTAACACTAGTTTGGGTAATCACAAGTTTGACTATATCCGCATTGGAAACAAAAAATTAT
TACAGGCACAAATTTAAAGACAATCACGTAGCCCCCTACGCCATAATACCTTTTATAATC
TAGTAATGTGCACACTAGGGCATTCATATACATATATATATAGACGCGGTAAAGAACCAC
TTTACTTTCACTATTATCACTTTACCACTAATTAGACAGCAAAGGCTCGTATACGTGTCA
TTAAAAACGAAGGTAAGGCCATACCTTTTTGAGGCAGTTGGAAAGAGTAAATACTGGCAC
AGTGGCTAAGACCTATCACTGCCAAACAAAAGGTTAGACATCTTGGGAATTTCGGACACA
TTCGTTACTTAAAACGAGGACCAAAATTACTCAATACCTATTTTTTATTTAATATTTTAG
GCATTGTTTCACCTGAATTTGCTGCTATTAGAAGCCTGATCTACGCAATAAAAGATTTCA
TCTGGATTTTTGAAGCTTATACAGTACTCAACAATCAGCTTATTAACAGCAATATACCGT
TAAGCAATTGAGAAAAAGTAACAATCAGAGCACTTGTGTGGCATAACGTTAATCTGAAAA
AGAAAGGGGTATCAGTGTGCACGGAAAACTTCAGAGACAA
Chr coordinates Chr IX from 261437-264892
w3c xhtml validator w3c css validator