Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL34B
Systematic Name YIL052C
Alias eL34, L34B, L34e
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl34Ap and has similarity to rat L34 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL34B YIL052C
TTCAAAACGTTAAGAATATCTTAGCAGAAAGTAATTCTTCTTTAGACAATATAGTCAAAG
TCAACGTATTCTTGGCTGACATGAAAAACTTTGCCGAATTCAACTCTGTATACGCCAAAC
ACTTCCACACCCATAAGCCTGCAAGATCCTGTGTTGGTGTTGCTTCCTTACCTTTGAATG
TTGATTTAGAAATGGAAGTTATCGCTGTTGAAAAGAATTGAAGGATTGAAACTTCTTTAC
TGCCTTTTTTCCACTTGCGATACCGAGGAGTGTACATTTATAAACATTTTAGTAGCATTC
TTTAGCGTATATAAGATTTTAACTAAGAAAAGAAACGAATTTACGGAGTTTCAGAATCAG
TTTCTTGCCGTTGTAGAAAATGTGAGGGGAGTTTCCCTCTACTTGTATCAATGTTACAAG
ACAGGGGTAGAAACCTATTACGTGTTGGAACTTATTTTCTTGAACACTCTAATCATAAAT
TCTAAAAAACTGTGACTGTGTTTTCGTCACAACTTTGCGGTGTACAGATGTCGTCACATA
CCGTGTGTTGTTTGGGTGTTTTCCTTTCAGCTTTTTTTTTTTTGAATTTTTGAATTTTTA
CTTTCATTTGCTTTCGGAGGTCCCGCTTCCGACAATAGTCCGCTTCATTTGTCCCTTCCC
ATGAAAGTTCATTCCTTTGGGCAGAGAGACCGTCCTTCTGGGAGGAGATGGAATTGACGC
CTGGGGGAGGAGCCAGTAACAATTCTAACTCTTCCTCTTCCTGTCAGTGGCCCCAGCACC
CGTTCAGACGGTATGGTAACGGGCTCTCAGGAGCCGTTTCATCGCAGCTGGTGGGTAAGT
TTGGAATGTTTCAATAGCATTCTACGTAAAAGTTGATGAACTTATTAGTTGTAAGTAGTA
AATAACGGGTAGTACATAGTATTTGGCACTTGTTATATTCTTTTGATTCAATTTACTTTG
ATTGAAACTGAGAATAGATTAGCAACGAACAACCCTAAAA
Chr coordinates Chr IX from 256554-256226,257063-257027
w3c xhtml validator w3c css validator