Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIL054W
Systematic Name YIL054W
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIL054W YIL054W
AACAGATCATGATAATCCCATTGGTAGGTGTTCAAAGTAAGTAGTAAGTTTTCCAGGGAC
TCGTTATCTATCGAGTTCTTCAGAATGACAATGCAACTCTGAAAAGTAATAAAAGGAGGA
ACCATGGAAGTCATTGGAGGCAGCATTTTCACCTGTAAAATATTGGTATGGTATATGATT
CCGCCTATCAAATATTTTACCTGGGCCCAAGTCTTGCCCGGAGGGAGATTATCAATCCTT
ATGGGAATACCATTTGACTGCGAGTACGTCTTTTTCCTAGGAGCAGCTTTTGTGCTTGCT
GTTGAGCTTTCGGTCGCAGAACGGGCAACAAAGGCACTGGCTGAAGCAGCCGACTTGGCA
CTATAGTGTGGTTCTAGAGTCATTATAAAGCAAGCGTATTGTAAGGAGAGACAGCAAACT
CTCGTGTATCAGCCAACTGAACTGGAGGCCAAGACCAATCTAAAAAAAAAAAAAAATGAA
AGAAACAAGTGTGGGAGGAAGTCTTGTTAACTTAACAGTTAAGCAAGCGTAAAAACCTTT
AGGAAAGCGCACGAAAGAAGGCCAACATTACGACTATGGAATAATACAATGCACACAAAC
AAAAGGTAACATTTGAAAAATGGAGTAGAGAATATATTCCATTCCCCTAATTTTTTGCGG
GTCTTCCAGGGCTGCGAACCCATCGCTCAAAACAAGCGCAGTGTCAATTAAGACATCATT
GAACTAAAACGGAAAATTTGCTTGCGCCACACACCCTGGTCAATCGTACCAAGGGATATC
ACTCTGTACGGGTGGGAGGAAGGCGCGGCAATTAGAATGTGTGGGTGCGGAAGCTCGCCG
CTCCCATCAAGAGAGTGGAAGACGTATGGTCTGGGTGCGAAGTACCACCACGTTTCTTTT
TCATCTCTTAAGTGGGATTCTTACGAAACACGTCACAGGGTCAAAAGAAAGAGAACAAAA
GCAATATTGTAATTGTCTCAGTCCACGGCAATGACATGGC
Chr coordinates Chr IX from 254543-254860
w3c xhtml validator w3c css validator