Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VHR1
Systematic Name YIL056W
Strain S288c
Description Transcriptional activator, required for the vitamin H-responsive element (VHRE) mediated induction of VHT1 (Vitamin H transporter) and BIO5 (biotin biosynthesis intermediate transporter) in response to low biotin concentrations
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VHR1 YIL056W
CCTCACACAGATTGGTGATCACGCACCCATAATCATTTCTTCGGGCATGCTCCTATTAGC
CACGGTTCGCAGAATAATCTGCGCGATGTTATTCACCAAGACCGTGGAGTCTCCTTTTCG
GTGGGATCCGCTTATATCCGTATGCGTCGGTTGCTTTCTCGGGGAAAGGAAAAGGAGAAA
GCCCGGATAACACGACACAAGAGTCATTCGTTATGCACGGACACAGGGAATCGTGCGGAG
CCGGGGATAAGAGGCCGTGCTAATTTCCGCGGAACATCGGAATGCAGTGGACAAGTGCCC
TGAGAACAAGCGGCGGGCGGGTAGCTGCCACGGAATAGGCGCCACGTTTCCGTGGGTGAC
TATGACTTTTGATCGATTCCATGTTGTTTTGCCCTGAATTCTGCGCCCCTCGGAGAAGTT
TCTTTTCTTTTTTATCTCTTTTTCATCTCTGACCTTCGTTTCCTTTCATATAGACTACGC
AGCAGAATCATGGCAGGAGCTATTAGCTGAGTGGGCAGATTACGTTTGCGCACTGTGCAT
TGTGACAGATTATATTTGCTTCGCTTCTCCCTCTTACTTCTTCAGCATAAGTGTAAGCCA
TATGTTCCCTGAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTACTATAAATCA
ATGTGCTCTCTTCCATGATTCTTGCCTTTTGGATCTTCGGTACTTGTGTGGGTGAGAATG
GTGTTATTGAGTCAATTCAGGTCAGCTTGGTTCAGTTCTAATCTAGCCCTTTCCCTACTA
TACAAATACTACTAGCCTTTTTTTTTCTCTCTCTTTCTCTATACCACTACCTCTTCCTCT
TCCTTTTTTTTCTCTTCTTTTTCTATTGTCCCCATCGCATCTTAGCATAAACGCATCCGC
ATTCCCTTCCTACATTTTTCTTTTCTACTAGTTATAGCTTTAAAACCTTCTTTATTCTCT
TTCTACCTATTCTTCTTCGTTGCTTATATCCTATACACAT
Chr coordinates Chr IX from 249991-251913
w3c xhtml validator w3c css validator