Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name VHR1
Systematic Name YIL056W
Strain S288c
Description Transcriptional activator, required for the vitamin H-responsive element (VHRE) mediated induction of VHT1 (Vitamin H transporter) and BIO5 (biotin biosynthesis intermediate transporter) in response to low biotin concentrations
External source Open in SGD external link
Orthologs
Candida albicans SC5314CR_00630W_A
Candida glabrata CBS138CAGL0J03014g
Candida parapsilosis CDC317CPAR2_804070
Candida tropicalis MYA-3404CTRG_01006
Zygosaccharomyces bailii IST302ZBIST_2472/ZbVHR1
Kluyveromyces lactis NRRL Y-1140KLLA0_C08151g
Kluyveromyces marxianus DMKU3-1042KLMA_70180
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VHR1 YIL056W
CCTCACACAGATTGGTGATCACGCACCCATAATCATTTCTTCGGGCATGCTCCTATTAGC
CACGGTTCGCAGAATAATCTGCGCGATGTTATTCACCAAGACCGTGGAGTCTCCTTTTCG
GTGGGATCCGCTTATATCCGTATGCGTCGGTTGCTTTCTCGGGGAAAGGAAAAGGAGAAA
GCCCGGATAACACGACACAAGAGTCATTCGTTATGCACGGACACAGGGAATCGTGCGGAG
CCGGGGATAAGAGGCCGTGCTAATTTCCGCGGAACATCGGAATGCAGTGGACAAGTGCCC
TGAGAACAAGCGGCGGGCGGGTAGCTGCCACGGAATAGGCGCCACGTTTCCGTGGGTGAC
TATGACTTTTGATCGATTCCATGTTGTTTTGCCCTGAATTCTGCGCCCCTCGGAGAAGTT
TCTTTTCTTTTTTATCTCTTTTTCATCTCTGACCTTCGTTTCCTTTCATATAGACTACGC
AGCAGAATCATGGCAGGAGCTATTAGCTGAGTGGGCAGATTACGTTTGCGCACTGTGCAT
TGTGACAGATTATATTTGCTTCGCTTCTCCCTCTTACTTCTTCAGCATAAGTGTAAGCCA
TATGTTCCCTGAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTACTATAAATCA
ATGTGCTCTCTTCCATGATTCTTGCCTTTTGGATCTTCGGTACTTGTGTGGGTGAGAATG
GTGTTATTGAGTCAATTCAGGTCAGCTTGGTTCAGTTCTAATCTAGCCCTTTCCCTACTA
TACAAATACTACTAGCCTTTTTTTTTCTCTCTCTTTCTCTATACCACTACCTCTTCCTCT
TCCTTTTTTTTCTCTTCTTTTTCTATTGTCCCCATCGCATCTTAGCATAAACGCATCCGC
ATTCCCTTCCTACATTTTTCTTTTCTACTAGTTATAGCTTTAAAACCTTCTTTATTCTCT
TTCTACCTATTCTTCTTCGTTGCTTATATCCTATACACAT
Chr coordinates Chr IX from 249991-251913
w3c xhtml validator w3c css validator