Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EFM4
Systematic Name YIL064W
Alias SEE1
Strain S288c
Description Probable lysine methyltransferase involved in the dimethylation of eEF1A (Tef1p/Tef2p); sequence similarity to S-adenosylmethionine-dependent methyltransferases of the seven beta-strand family; role in vesicular transport
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EFM4 YIL064W
TTTTCCCATCTTGTCGTTTGGTCCTCGCCATGGCAACCGGGTTTTTGCCCCTTTGAGCAG
CGCCTAGGTGTCGTTGCTGCGACAACCACGAAAAAAAAAAAAAAAAAAAAACAAAAGAAC
AACGGCACGCAATGTTGCTGTGACAACCGTAGGCAGATAACTTGGCTTTTTTTACTACTT
TAGGAAAATTAGCAGCCAAGAACGAGGGCTTGCTCTGCTACCTAGTTCAAACTGAAACAA
GCCTTCACTTTCTTTTCTTTTCTTTTTTTTTTTATCTAACAACTGAAGATTAAATGATAA
ATGTTTACGCGTGCGTGCGATTCATTCTTATGTATGTACGTATGTGCTGATTTTTTATGT
GCTTGTTACCTTCTCTTGTTTCTTAAGAAGAAACTAGCCACGGCCACAGCGCCGGCTAGT
ACGCCTCCAGCGACGACAACACCCTTGAGTGTTTCCTTCTGGATCTTATCCTCTACCATA
CTCTTCAAAGCGCCCACCTGCTTGTTATTACGCTCATGCTCAAATAAAGTGTCTACATAT
CTCTTCGCCATAGAGTATTCACCGAGTTTGTAGCAACCTATGGTCAGATAATATAGGCAT
TCTCGTCTACGGGACTCGGCCTCTTTGTAAATGTCTGTGAGGATTTTCACACCAAGCCTT
TCGTCATTCACGTCAGTGGATTTGATCAGCCCCCATGCGTAGTTAAACCTTGACTGTATG
GTAGCGGTGGGCCCCCCCTCGGAGACGACTTGCTGGCGCAGAATCTCCAGCTGCTGCGGA
TAGAGTGGTTCGTATGCGTCCTTAAGAGTTGGCCAAAAATCTACTTTGGTCATACTTATG
TTGTATGGCTGTGCTCTGATCTGTGCTTCTATGTGCCGTTTTTACGCAAGGTATATGATA
ACTTCTGTGCAGAATAGTGGCAATGGCAGCTTTGCTTTGAAAGGGGTCCAGCCTAGCCCG
CTTGCGGTGTTCCGGCATAAATGCGCAAAAAGATTGGTTC
Chr coordinates Chr IX from 241943-242716
w3c xhtml validator w3c css validator