Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RNR3
Systematic Name YIL066C
Alias DIN1, RIR3
Strain S288c
Description Minor isoform of the large subunit of ribonucleotide-diphosphate reductase; the RNR complex catalyzes rate-limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNR3 YIL066C
AGATTCTGCGCCAGCAAGTCGTCTCCGAGGGGGGGCCCACCGCTACCATACAGTCAAGGT
TTAACTACGCATGGGGGCTGATCAAATCCACTGACGTGAATGACGAAAGGCTTGGTGTGA
AAATCCTCACAGACATTTACAAAGAGGCCGAGTCCCGTAGACGAGAATGCCTATATTATC
TGACCATAGGTTGCTACAAACTCGGTGAATACTCTATGGCGAAGAGATATGTAGACACTT
TATTTGAGCATGAGCGTAATAACAAGCAGGTGGGCGCTTTGAAGAGTATGGTAGAGGATA
AGATCCAGAAGGAAACACTCAAGGGTGTTGTCGTCGCTGGAGGCGTACTAGCCGGCGCTG
TGGCCGTGGCTAGTTTCTTCTTAAGAAACAAGAGAAGGTAACAAGCACATAAAAAATCAG
CACATACGTACATACATAAGAATGAATCGCACGCACGCGTAAACATTTATCATTTAATCT
TCAGTTGTTAGATAAAAAAAAAAAGAAAAGAAAAGAAAGTGAAGGCTTGTTTCAGTTTGA
ACTAGGTAGCAGAGCAAGCCCTCGTTCTTGGCTGCTAATTTTCCTAAAGTAGTAAAAAAA
GCCAAGTTATCTGCCTACGGTTGTCACAGCAACATTGCGTGCCGTTGTTCTTTTGTTTTT
TTTTTTTTTTTTTTTTCGTGGTTGTCGCAGCAACGACACCTAGGCGCTGCTCAAAGGGGC
AAAAACCCGGTTGCCATGGCGAGGACCAAACGACAAGATGGGAAAAAAACAATAGTCTAT
TGTTAAATCGTAATACTGTATTGTGAGATGCTGACGCGTTTCGTTTTTCGTGTCAGCGTT
CTTTATATTGTTTCGTGTTCTGCTGCAAAACGTATATAAACGCACTGCTATTTTGCCTTC
TTTTGCCTTCTTCCTTGCCTTTCTCTCATCTCATATCCAAGTTGAAATAAATATGACAAG
CAAGAATAGCAGCAGCAATAAATCAAATACTCCCACACAA
Chr coordinates Chr IX from 240708-238099
w3c xhtml validator w3c css validator