Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SER33
Systematic Name YIL074C
Strain S288c
Description 3-phosphoglycerate dehydrogenase, catalyzes the first step in serine and glycine biosynthesis; isozyme of Ser3p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SER33 YIL074C
CTATACATCTGGAAAGTGCCTTAATGATGCCTGATCAAACTAGGATTCTGGACATATTGA
AGAAAACGGAATTGTATCAAGATAGCCGCGTGGATGCGCTACTTATTGATATCTCGTCGA
ATATGGAAGATTTACCTAAAGGAGTTCTCATAGAGATACTTGAAACAGTATTAAAAAGAA
ACATGGGCCCTGAAGTGAAAGAACGGGAACTCTGTAGCTGGCTGCGAATTTTACTGGAAA
ATGCAATTAATCTTAACCATGAGGTCGAACTACGCATATTGGATAGGGTTCTTAAGATCC
TAAATATAAATCAATCAAGTCTTCAAGACACAGATGGTGTCCTTCAAACAGAGTTAGAAA
CTATAGCCACTTACTGTTGGAATATCGGCGTCAATTACATAATCAAAGACAACAAAAGCA
ATGGAATTGTTTGGTGTAAACATTCAATGGGGTTCGCAAACATGGTTAATGAAGGCTTGC
AGGAGCAATTGTACTCTTTATGGGAGTCTTTAGCAAGTTCGGCAAATATCGATATCAATA
GTATTGCTAAATAAACCTTTTTTATTCCATTTACTGTCGTTTATACTGGCTGACCCTTAA
TTCCCTAGCAATCTTTGCCTGCACCCGTACCAGGAAGCGTGATAGAATCGGTAGCTACAA
AATTTTTAGCATAGTTAATAAGTGCTATTGTTTTTCATAATGTCACGTGCACTATCAATA
ATATTACACTCTTGTTCTTGCCAAATATACACAAAATGCCACATTTTTTTCTTTACACCG
AAGAATTTGGCCGTCAGCCGGACAGCGCTCAGATTAATTGTGGGCTAGATTCTTCACGCT
GGAAACGAGTCACCGTTATGAAAACTAATGGAATCTCCCAGGTTTAATACATAAGAAGGT
TACGAGCTACTACATTAAAAAATACTTTGTCTGTTTTAGCTGTAGATTATTGTAACATTA
AAAAGTAACAAACACTGATTTCGGGTATTTCCTCCCTAAC
Chr coordinates Chr IX from 222490-221081
w3c xhtml validator w3c css validator