Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEC28
Systematic Name YIL076W
Alias ANU2
Strain S288c
Description Epsilon-COP subunit of the coatomer; regulates retrograde Golgi-to-ER protein traffic; stabilizes Cop1p, the alpha-COP and the coatomer complex; non-essential for cell growth
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC28 YIL076W
TTCCTCGGCACCTTAACACCTTTAATAGCCTTGGTCTTGTAGTAACGATAGGCAAATGGA
GTTAAAAATACAGCTGAAAACCCAAGCCAACCACCCCACATCTCAGCTTTAGCAATGGAT
CTATAGGCCTTCGATAACTCCAGCCTGTCTCTTGCATCCAGCAATTCGTCTTTTTCATGA
AATTCAATAGCATTTTCATAAGCCTTTTTAAACCAAGGCCTCTTCATAAAGGGTAGTTCA
TTTTCCATTCCCTTACCATTCTGGCCATATTGCTGTTCTTCTTCTTTTCCCAACATCACC
TTGTTCTACGCTTGAAATTAGGCTGCTCCTTAAAACGAAAATCATATTAAGCATTGACAC
ATAAAAAGTTCTGTTCTGCGTCAAAGTAGCATTAGCTCATAAGGCTTTCACCCTTGCTTG
ACTTACACCCGCGGAAATAAAAACACAGAAAAAGAAGGAAATAATGTATAAACAAGTAAC
TATGAACGAAATTTCCTGTTACGGATTGTTACGCTAGCTATTAAAATTCGTCTCGTCAAA
GATCGACTGTAGCAGCGTGCTGCTGATGTCAAAGAATTGGGAGCCACAAGCTGGTGAAAT
GGTATCTGTCTTAGTACTCACAACATTCTAGGCTGCAAAAGAGGTTATACCGGAACAATA
GTTGCTAAAATGGAATTCAGGAGATGGCTCCAACGCAACGATCAGGACGCCCGCTGATCT
CACTCTTTAGTGTCCACACTATATAGTAACATTACATTCAATTGGAACCGTAATGTTGTA
TAAAATCTTTTGTCTTGCTGTATAGGTGCGTATGCAGCGTCTTCAATGGGATAAAGATAT
TCTATTTTTAATTTTTAAGGTGATCTTAATTTTTTGTTGGTTCTTTTTCAGTTTTTTGTC
AAGCGAAAAACTACAGTTTCTACAGAAAAACACGTCAAGCTACAGTATAAGAACGGATTG
TGAAGAACTCGGTGGAGAACATAGAAACAGACAAAAAATC
Chr coordinates Chr IX from 216658-217548
w3c xhtml validator w3c css validator