Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SGA1
Systematic Name YIL099W
Strain S288c
Description Intracellular sporulation-specific glucoamylase involved in glycogen degradation; induced during starvation of a/a diploids late in sporulation, but dispensable for sporulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SGA1 YIL099W
CGTTCTGCGCCGCCGCCTCTTCCCCGTTCCCTGCGTCCCGAGCACTGATAATGAAGTTTG
GATGTGTGAACTGCGCAGCAATGGAGGATTTATAGTTAACCTTTCTAATATTGAGTCCGG
CGCTGAAACTGGCCGGCGGCGAGTCCCTATCCAGTACGCTGACGAGGTAGAGACGCTGAT
AGTCGTCCAGGGGGTTGTCCGTTAAGTGTACCGTGTCACTGTTAATGCTAAAAGCGGGAT
ATTTCATGTTGGAGAAGGTGTCTATGATAAGGTATTTTGAGCTTGCCGTTGTGTGGGGAG
AAGAACTGGATGCGTACCGAGAACGAGCAAGTTAAAACACTAGTACACGAATAATAGATA
TATATATGTATGTATATATATGTTGAAGTGTGTACACACGTACACGCACAAGCTACAGAC
GCCACGCGGCCCGGCATTCATATATGTACATACATTTATGCACATATATATATATATATA
TATGTATATGTAAATGTATATATACAGCTTGTGATTTCGCGCGCCGAATGGGCTGAAAAG
CACAGTATAGTGGAGAAGAAGAGAGAGGAGAAGGGGAGAGGGGCAATAGCAATGGATGTG
GTAGAATACAGGGAAGGCCAAGCTGTTGTTCAATGGATGCGGTTCGAGGCCCAGCGCAAG
GGGGGCGCTTCGAAGCATAGAACATTATCCGCGGAAACGGGTATTAGGGGTGAGGGTGAA
TAAGGAAAGTCAGGGAAATCGGGCCAGAGTAACACCCATTCATAGCACTCGTACAAGGTG
CTTTTAACTTGCCTGCATGTGTGGAGTCACAAATTAGGGGACTCAGGCACAGAAGCAAGG
GTCCTTTTTTGGTTCCCTGTTTCCTCCTGCGCATTTCGTATTTTTTCTCATCTCTTGGCT
CTGGATCCGTTATCTGTTCTGTTACACAAGAAATCGTACATTTACAATATAGTGATAATC
GTGGACTAGAGCAAGATTTCAAATAAGTAACAGCAGCAAA
Chr coordinates Chr IX from 178004-179653
w3c xhtml validator w3c css validator